FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634611_at:

>probe:Drosophila_2:1634611_at:209:67; Interrogation_Position=119; Antisense; ATGGACGTGATGAGCACTCGCCGCT
>probe:Drosophila_2:1634611_at:507:145; Interrogation_Position=134; Antisense; ACTCGCCGCTCATTGGGAAGTTCTG
>probe:Drosophila_2:1634611_at:214:527; Interrogation_Position=165; Antisense; GGGCAAGTTCCCATTCAGCATTATT
>probe:Drosophila_2:1634611_at:58:171; Interrogation_Position=18; Antisense; AAAGTCGACTAATCTGCCGTGTGAG
>probe:Drosophila_2:1634611_at:590:57; Interrogation_Position=209; Antisense; ATGTGGAGTTTGTTACTTCGCCGGC
>probe:Drosophila_2:1634611_at:256:241; Interrogation_Position=247; Antisense; AATACAGGCTTCCATTTCAACGTTG
>probe:Drosophila_2:1634611_at:572:571; Interrogation_Position=326; Antisense; GGCTACTGAGCTCCGATTCTTTAAA
>probe:Drosophila_2:1634611_at:314:123; Interrogation_Position=364; Antisense; AGCGAGGGCATCTTCCTTAGCATCG
>probe:Drosophila_2:1634611_at:538:511; Interrogation_Position=38; Antisense; GTGAGAATGTGATGACCTGCCCCAT
>probe:Drosophila_2:1634611_at:707:269; Interrogation_Position=436; Antisense; CATGTCGGTGAAATTGTGCGCCTTT
>probe:Drosophila_2:1634611_at:222:621; Interrogation_Position=452; Antisense; TGCGCCTTTATTTCCCCAGAAGGAA
>probe:Drosophila_2:1634611_at:118:309; Interrogation_Position=59; Antisense; CCATCAGGCCGATCGGATCTGGTAA
>probe:Drosophila_2:1634611_at:131:451; Interrogation_Position=74; Antisense; GATCTGGTAATGAGCACTGTCCCTA
>probe:Drosophila_2:1634611_at:464:277; Interrogation_Position=96; Antisense; CTACGACTGGTTGGCCGTATACGAT

Paste this into a BLAST search page for me
ATGGACGTGATGAGCACTCGCCGCTACTCGCCGCTCATTGGGAAGTTCTGGGGCAAGTTCCCATTCAGCATTATTAAAGTCGACTAATCTGCCGTGTGAGATGTGGAGTTTGTTACTTCGCCGGCAATACAGGCTTCCATTTCAACGTTGGGCTACTGAGCTCCGATTCTTTAAAAGCGAGGGCATCTTCCTTAGCATCGGTGAGAATGTGATGACCTGCCCCATCATGTCGGTGAAATTGTGCGCCTTTTGCGCCTTTATTTCCCCAGAAGGAACCATCAGGCCGATCGGATCTGGTAAGATCTGGTAATGAGCACTGTCCCTACTACGACTGGTTGGCCGTATACGAT

Full Affymetrix probeset data:

Annotations for 1634611_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720