Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634613_s_at:

>probe:Drosophila_2:1634613_s_at:219:419; Interrogation_Position=107; Antisense; GAGCTTTGCTCTTAGATTGGGATCT
>probe:Drosophila_2:1634613_s_at:198:593; Interrogation_Position=124; Antisense; TGGGATCTTCAATCGGGTGTTTTCA
>probe:Drosophila_2:1634613_s_at:14:533; Interrogation_Position=139; Antisense; GGTGTTTTCACCGTACGATCTTAGG
>probe:Drosophila_2:1634613_s_at:96:161; Interrogation_Position=238; Antisense; AAATTGGTGCTTTAACTGTTGGAGG
>probe:Drosophila_2:1634613_s_at:416:531; Interrogation_Position=277; Antisense; GGGTAATCTGGCACTTATGGCATGA
>probe:Drosophila_2:1634613_s_at:274:569; Interrogation_Position=295; Antisense; GGCATGAACCTGACCATATAACGGG
>probe:Drosophila_2:1634613_s_at:1:151; Interrogation_Position=390; Antisense; ACATTATATGTCCAAGCTTACTCCA
>probe:Drosophila_2:1634613_s_at:402:11; Interrogation_Position=458; Antisense; ATTCTGCTTTGACTTATTTGTTACA
>probe:Drosophila_2:1634613_s_at:47:475; Interrogation_Position=477; Antisense; GTTACATAATACTCGGTCCACATTG
>probe:Drosophila_2:1634613_s_at:164:307; Interrogation_Position=544; Antisense; CCAGTTTCCTGGTGTTATGTTTATA
>probe:Drosophila_2:1634613_s_at:583:673; Interrogation_Position=567; Antisense; TAGTATTTAGCGTCGATTTCCGGAC
>probe:Drosophila_2:1634613_s_at:108:553; Interrogation_Position=588; Antisense; GGACGCCGGTGGCTTCACAAATACA
>probe:Drosophila_2:1634613_s_at:327:583; Interrogation_Position=597; Antisense; TGGCTTCACAAATACACGACGGAGT
>probe:Drosophila_2:1634613_s_at:37:691; Interrogation_Position=92; Antisense; TTTCGAGCAGACGATGAGCTTTGCT

Paste this into a BLAST search page for me
GAGCTTTGCTCTTAGATTGGGATCTTGGGATCTTCAATCGGGTGTTTTCAGGTGTTTTCACCGTACGATCTTAGGAAATTGGTGCTTTAACTGTTGGAGGGGGTAATCTGGCACTTATGGCATGAGGCATGAACCTGACCATATAACGGGACATTATATGTCCAAGCTTACTCCAATTCTGCTTTGACTTATTTGTTACAGTTACATAATACTCGGTCCACATTGCCAGTTTCCTGGTGTTATGTTTATATAGTATTTAGCGTCGATTTCCGGACGGACGCCGGTGGCTTCACAAATACATGGCTTCACAAATACACGACGGAGTTTTCGAGCAGACGATGAGCTTTGCT

Full Affymetrix probeset data:

Annotations for 1634613_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime