Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634614_at:

>probe:Drosophila_2:1634614_at:116:589; Interrogation_Position=1934; Antisense; TGGAGATACGCTGTCGCAACATGCC
>probe:Drosophila_2:1634614_at:536:359; Interrogation_Position=1949; Antisense; GCAACATGCCCCAGAGAGTCATCGA
>probe:Drosophila_2:1634614_at:446:431; Interrogation_Position=1964; Antisense; GAGTCATCGAACTGCAGGAGGCCAA
>probe:Drosophila_2:1634614_at:542:399; Interrogation_Position=2026; Antisense; TACTATTTAATAGCCGCCGAGGTCC
>probe:Drosophila_2:1634614_at:465:515; Interrogation_Position=2077; Antisense; GTGTCCTACGACTATTGGGTCTTCA
>probe:Drosophila_2:1634614_at:406:529; Interrogation_Position=2093; Antisense; GGGTCTTCAAGACGGCTGGCTATCT
>probe:Drosophila_2:1634614_at:431:167; Interrogation_Position=2135; Antisense; AAATGCCCAAGTTGCCATGCGATTG
>probe:Drosophila_2:1634614_at:329:715; Interrogation_Position=2252; Antisense; TTCTCATACGTGTCCTACCTTTATA
>probe:Drosophila_2:1634614_at:677:703; Interrogation_Position=2272; Antisense; TTATATGTATCCGACTGTATCTGCG
>probe:Drosophila_2:1634614_at:717:201; Interrogation_Position=2298; Antisense; AACCGTGTGCCTTCTATATTCATAC
>probe:Drosophila_2:1634614_at:456:517; Interrogation_Position=2362; Antisense; GTGTGCATGCACTTGACGATTTGTA
>probe:Drosophila_2:1634614_at:483:429; Interrogation_Position=2421; Antisense; GAGTAACGTTGATCAGCACCATTGC
>probe:Drosophila_2:1634614_at:227:355; Interrogation_Position=2436; Antisense; GCACCATTGCTTAGGGTCGTGAGCT
>probe:Drosophila_2:1634614_at:333:501; Interrogation_Position=2451; Antisense; GTCGTGAGCTTAGTCAGCCTACTTA

Paste this into a BLAST search page for me
TGGAGATACGCTGTCGCAACATGCCGCAACATGCCCCAGAGAGTCATCGAGAGTCATCGAACTGCAGGAGGCCAATACTATTTAATAGCCGCCGAGGTCCGTGTCCTACGACTATTGGGTCTTCAGGGTCTTCAAGACGGCTGGCTATCTAAATGCCCAAGTTGCCATGCGATTGTTCTCATACGTGTCCTACCTTTATATTATATGTATCCGACTGTATCTGCGAACCGTGTGCCTTCTATATTCATACGTGTGCATGCACTTGACGATTTGTAGAGTAACGTTGATCAGCACCATTGCGCACCATTGCTTAGGGTCGTGAGCTGTCGTGAGCTTAGTCAGCCTACTTA

Full Affymetrix probeset data:

Annotations for 1634614_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime