FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634615_at:

>probe:Drosophila_2:1634615_at:461:645; Interrogation_Position=1008; Antisense; TCTTCTGCGAACTGATGTCCTTTGA
>probe:Drosophila_2:1634615_at:191:541; Interrogation_Position=1036; Antisense; GGTTGTACCGATCATGCCTCTGCAA
>probe:Drosophila_2:1634615_at:519:387; Interrogation_Position=1133; Antisense; GAAAATCGATGGTCGCTATCGCCAC
>probe:Drosophila_2:1634615_at:41:635; Interrogation_Position=1151; Antisense; TCGCCACCGGTCAGCAGATATGTCA
>probe:Drosophila_2:1634615_at:709:51; Interrogation_Position=1178; Antisense; ATGGAACCGGAATCCTTTCTCGGCT
>probe:Drosophila_2:1634615_at:724:55; Interrogation_Position=1245; Antisense; ATGAGCGGCTCTGGATGATGCGACA
>probe:Drosophila_2:1634615_at:394:107; Interrogation_Position=1281; Antisense; AGAACGATCCAAACTCCGACATGTT
>probe:Drosophila_2:1634615_at:497:401; Interrogation_Position=1298; Antisense; GACATGTTTTTTCCGGATCGCGAAG
>probe:Drosophila_2:1634615_at:23:171; Interrogation_Position=1325; Antisense; AAAGGACGTGATTCGCTCACTTCGT
>probe:Drosophila_2:1634615_at:424:715; Interrogation_Position=1345; Antisense; TTCGTTCGCCAACTAAGGTCACTAA
>probe:Drosophila_2:1634615_at:461:559; Interrogation_Position=841; Antisense; GGAAATCATTGACCACCTGCAGAAG
>probe:Drosophila_2:1634615_at:662:119; Interrogation_Position=900; Antisense; AGCTGTGGAGCATCCTATCGATACC
>probe:Drosophila_2:1634615_at:374:587; Interrogation_Position=951; Antisense; TGGAGCGCAACTACATCGACCATGT
>probe:Drosophila_2:1634615_at:552:715; Interrogation_Position=986; Antisense; TTCGGAACCGTGGAGCAAGCCATCT

Paste this into a BLAST search page for me
TCTTCTGCGAACTGATGTCCTTTGAGGTTGTACCGATCATGCCTCTGCAAGAAAATCGATGGTCGCTATCGCCACTCGCCACCGGTCAGCAGATATGTCAATGGAACCGGAATCCTTTCTCGGCTATGAGCGGCTCTGGATGATGCGACAAGAACGATCCAAACTCCGACATGTTGACATGTTTTTTCCGGATCGCGAAGAAAGGACGTGATTCGCTCACTTCGTTTCGTTCGCCAACTAAGGTCACTAAGGAAATCATTGACCACCTGCAGAAGAGCTGTGGAGCATCCTATCGATACCTGGAGCGCAACTACATCGACCATGTTTCGGAACCGTGGAGCAAGCCATCT

Full Affymetrix probeset data:

Annotations for 1634615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720