FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634616_at:

>probe:Drosophila_2:1634616_at:481:439; Interrogation_Position=467; Antisense; GAGGCTCTGCACAACAATCCCAAGG
>probe:Drosophila_2:1634616_at:580:585; Interrogation_Position=492; Antisense; TGGAAGCCAGTCCATGTGGCACCAA
>probe:Drosophila_2:1634616_at:83:355; Interrogation_Position=510; Antisense; GCACCAAGTTCAGTTTCAAGCCAGT
>probe:Drosophila_2:1634616_at:285:335; Interrogation_Position=559; Antisense; GCTGATGCGTCTGCTCAAGCAACAT
>probe:Drosophila_2:1634616_at:69:331; Interrogation_Position=600; Antisense; GCGGCATTTTGCTGGACGATGTCCA
>probe:Drosophila_2:1634616_at:616:563; Interrogation_Position=625; Antisense; GGAATCTCTACCACACTGCGAAAAG
>probe:Drosophila_2:1634616_at:698:201; Interrogation_Position=659; Antisense; AACCGATCAGCCGAAATACTTTTTG
>probe:Drosophila_2:1634616_at:543:369; Interrogation_Position=730; Antisense; GACTGCTAATTTTTCGGTGGACGAC
>probe:Drosophila_2:1634616_at:1:95; Interrogation_Position=756; Antisense; AGTTCCAGAAGCTATGGCGCTCGGC
>probe:Drosophila_2:1634616_at:219:337; Interrogation_Position=774; Antisense; GCTCGGCTACGGTCGATGCAATGGA
>probe:Drosophila_2:1634616_at:414:409; Interrogation_Position=800; Antisense; GACGCCAAGATTGACGAGTACCTCG
>probe:Drosophila_2:1634616_at:79:109; Interrogation_Position=825; Antisense; AGAAGCAGGGCATTCGCTCCATGCA
>probe:Drosophila_2:1634616_at:437:53; Interrogation_Position=845; Antisense; ATGCAGGACCATGGCCTCAAGAAAG
>probe:Drosophila_2:1634616_at:156:191; Interrogation_Position=933; Antisense; AACATTTGGCCGACGTTCTGGAGGT

Paste this into a BLAST search page for me
GAGGCTCTGCACAACAATCCCAAGGTGGAAGCCAGTCCATGTGGCACCAAGCACCAAGTTCAGTTTCAAGCCAGTGCTGATGCGTCTGCTCAAGCAACATGCGGCATTTTGCTGGACGATGTCCAGGAATCTCTACCACACTGCGAAAAGAACCGATCAGCCGAAATACTTTTTGGACTGCTAATTTTTCGGTGGACGACAGTTCCAGAAGCTATGGCGCTCGGCGCTCGGCTACGGTCGATGCAATGGAGACGCCAAGATTGACGAGTACCTCGAGAAGCAGGGCATTCGCTCCATGCAATGCAGGACCATGGCCTCAAGAAAGAACATTTGGCCGACGTTCTGGAGGT

Full Affymetrix probeset data:

Annotations for 1634616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720