FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634617_at:

>probe:Drosophila_2:1634617_at:232:229; Interrogation_Position=241; Antisense; AATGGAGTGCGTTGGATCCGACCAC
>probe:Drosophila_2:1634617_at:332:305; Interrogation_Position=296; Antisense; CCTCCACTTTTCACTCGGAAGATTA
>probe:Drosophila_2:1634617_at:728:85; Interrogation_Position=337; Antisense; AGTCGATTTCAGTTGCTTCACTTGC
>probe:Drosophila_2:1634617_at:208:713; Interrogation_Position=353; Antisense; TTCACTTGCCTCATTGCGATTGCAA
>probe:Drosophila_2:1634617_at:335:723; Interrogation_Position=372; Antisense; TTGCAACACGGGTTCAACTTCAAGT
>probe:Drosophila_2:1634617_at:197:667; Interrogation_Position=424; Antisense; TACAGTTGAGCCTCTCTACCGTGTA
>probe:Drosophila_2:1634617_at:368:339; Interrogation_Position=444; Antisense; GTGTACTTTCCTCAAACGCGGTCAC
>probe:Drosophila_2:1634617_at:228:135; Interrogation_Position=459; Antisense; ACGCGGTCACATTTGCATAGCAGCA
>probe:Drosophila_2:1634617_at:154:63; Interrogation_Position=574; Antisense; ATGTGAATCCAAGAGTTCGGCACTT
>probe:Drosophila_2:1634617_at:325:639; Interrogation_Position=590; Antisense; TCGGCACTTGTCGTGTCTTCAAAAG
>probe:Drosophila_2:1634617_at:118:183; Interrogation_Position=610; Antisense; AAAAGCTTTGCTGCCTTGACTTTGA
>probe:Drosophila_2:1634617_at:590:315; Interrogation_Position=622; Antisense; GCCTTGACTTTGACTTTGGCCAAAA
>probe:Drosophila_2:1634617_at:378:183; Interrogation_Position=643; Antisense; AAAAGCTCGCTTTTCAGCCAAGAGT
>probe:Drosophila_2:1634617_at:723:343; Interrogation_Position=774; Antisense; GCTTGTCTTGGTTCTTTAAGTCCGT

Paste this into a BLAST search page for me
AATGGAGTGCGTTGGATCCGACCACCCTCCACTTTTCACTCGGAAGATTAAGTCGATTTCAGTTGCTTCACTTGCTTCACTTGCCTCATTGCGATTGCAATTGCAACACGGGTTCAACTTCAAGTTACAGTTGAGCCTCTCTACCGTGTAGTGTACTTTCCTCAAACGCGGTCACACGCGGTCACATTTGCATAGCAGCAATGTGAATCCAAGAGTTCGGCACTTTCGGCACTTGTCGTGTCTTCAAAAGAAAAGCTTTGCTGCCTTGACTTTGAGCCTTGACTTTGACTTTGGCCAAAAAAAAGCTCGCTTTTCAGCCAAGAGTGCTTGTCTTGGTTCTTTAAGTCCGT

Full Affymetrix probeset data:

Annotations for 1634617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720