FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634619_at:

>probe:Drosophila_2:1634619_at:174:625; Interrogation_Position=1459; Antisense; TGCGCCTGGTCATCGAACAGTCGAC
>probe:Drosophila_2:1634619_at:19:97; Interrogation_Position=1501; Antisense; AGATCATTGGCTCCAGCATCTTTAT
>probe:Drosophila_2:1634619_at:525:671; Interrogation_Position=1530; Antisense; TACGATGACGATCGCGTTGGCGTTT
>probe:Drosophila_2:1634619_at:236:467; Interrogation_Position=1545; Antisense; GTTGGCGTTTGGCTAATTGACTTCG
>probe:Drosophila_2:1634619_at:79:249; Interrogation_Position=1559; Antisense; AATTGACTTCGCCAAGTGCCGGGAG
>probe:Drosophila_2:1634619_at:326:173; Interrogation_Position=1631; Antisense; AAACCGAGAGGAGGGTCTGCTACGC
>probe:Drosophila_2:1634619_at:23:341; Interrogation_Position=1649; Antisense; GCTACGCGGAATGGACGAGCTCATC
>probe:Drosophila_2:1634619_at:146:45; Interrogation_Position=1711; Antisense; ATCGCAGCTGCCTTAAAATCTAATG
>probe:Drosophila_2:1634619_at:86:105; Interrogation_Position=1739; Antisense; AGACACGGATCGATTGCACCGGCAG
>probe:Drosophila_2:1634619_at:190:353; Interrogation_Position=1772; Antisense; GCACCAAAAGACTGATCACCCAAGC
>probe:Drosophila_2:1634619_at:103:651; Interrogation_Position=1787; Antisense; TCACCCAAGCTCCATTTGTACAGAT
>probe:Drosophila_2:1634619_at:20:103; Interrogation_Position=1825; Antisense; AGAGAAGAGGATTCACCGCATCGCC
>probe:Drosophila_2:1634619_at:387:627; Interrogation_Position=1860; Antisense; TCCACCCTATATTAACTCCTTGTTC
>probe:Drosophila_2:1634619_at:273:163; Interrogation_Position=1893; Antisense; AAATATCGGGATTCAGCTCGGTTAG

Paste this into a BLAST search page for me
TGCGCCTGGTCATCGAACAGTCGACAGATCATTGGCTCCAGCATCTTTATTACGATGACGATCGCGTTGGCGTTTGTTGGCGTTTGGCTAATTGACTTCGAATTGACTTCGCCAAGTGCCGGGAGAAACCGAGAGGAGGGTCTGCTACGCGCTACGCGGAATGGACGAGCTCATCATCGCAGCTGCCTTAAAATCTAATGAGACACGGATCGATTGCACCGGCAGGCACCAAAAGACTGATCACCCAAGCTCACCCAAGCTCCATTTGTACAGATAGAGAAGAGGATTCACCGCATCGCCTCCACCCTATATTAACTCCTTGTTCAAATATCGGGATTCAGCTCGGTTAG

Full Affymetrix probeset data:

Annotations for 1634619_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720