Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634621_at:

>probe:Drosophila_2:1634621_at:631:415; Interrogation_Position=400; Antisense; GAGCCTGCGATTTCTTTTTGGCAAC
>probe:Drosophila_2:1634621_at:460:185; Interrogation_Position=422; Antisense; AACAATATGTTCATGCCCTCGGAGG
>probe:Drosophila_2:1634621_at:605:637; Interrogation_Position=440; Antisense; TCGGAGGCCTATACTCTGCACATAC
>probe:Drosophila_2:1634621_at:152:285; Interrogation_Position=455; Antisense; CTGCACATACCACATGATTCCATAT
>probe:Drosophila_2:1634621_at:62:265; Interrogation_Position=481; Antisense; CAGAGATCACTATTGCGAGCACCAT
>probe:Drosophila_2:1634621_at:686:71; Interrogation_Position=569; Antisense; AGGCTATTCTCCACCGAACTAAAAG
>probe:Drosophila_2:1634621_at:430:229; Interrogation_Position=613; Antisense; AATGGAGCTCCTTACAGACTCCGAT
>probe:Drosophila_2:1634621_at:610:45; Interrogation_Position=649; Antisense; ATCCCATTGTGACTCCTTTAATCTA
>probe:Drosophila_2:1634621_at:508:21; Interrogation_Position=684; Antisense; ATATATTAAGCCAACTTCCGCGCAG
>probe:Drosophila_2:1634621_at:319:209; Interrogation_Position=713; Antisense; AAGAACATACACCTGCATCTACTGC
>probe:Drosophila_2:1634621_at:688:131; Interrogation_Position=754; Antisense; ACCGAATGAATTACGCTGCTGCAAG
>probe:Drosophila_2:1634621_at:505:137; Interrogation_Position=795; Antisense; ACGATCTTGGCGTGCGGAATCTGGA
>probe:Drosophila_2:1634621_at:446:69; Interrogation_Position=900; Antisense; AGGCCGAGGTCATAGTTCGCGGTTT
>probe:Drosophila_2:1634621_at:691:477; Interrogation_Position=921; Antisense; GTTTCAGAGCTCCTGGCAACCAAAA

Paste this into a BLAST search page for me
GAGCCTGCGATTTCTTTTTGGCAACAACAATATGTTCATGCCCTCGGAGGTCGGAGGCCTATACTCTGCACATACCTGCACATACCACATGATTCCATATCAGAGATCACTATTGCGAGCACCATAGGCTATTCTCCACCGAACTAAAAGAATGGAGCTCCTTACAGACTCCGATATCCCATTGTGACTCCTTTAATCTAATATATTAAGCCAACTTCCGCGCAGAAGAACATACACCTGCATCTACTGCACCGAATGAATTACGCTGCTGCAAGACGATCTTGGCGTGCGGAATCTGGAAGGCCGAGGTCATAGTTCGCGGTTTGTTTCAGAGCTCCTGGCAACCAAAA

Full Affymetrix probeset data:

Annotations for 1634621_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime