FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634624_at:

>probe:Drosophila_2:1634624_at:140:659; Interrogation_Position=1037; Antisense; TAAGTATTTCTTTGGCCTCACTTTA
>probe:Drosophila_2:1634624_at:31:111; Interrogation_Position=503; Antisense; AGAATTCTGTGGTACGCACTCTCAA
>probe:Drosophila_2:1634624_at:113:651; Interrogation_Position=536; Antisense; TCACCCAAGTGATTGAGCGCTCCTG
>probe:Drosophila_2:1634624_at:159:451; Interrogation_Position=564; Antisense; GATCGATAGTCAACCCCAGGTGCTG
>probe:Drosophila_2:1634624_at:504:535; Interrogation_Position=582; Antisense; GGTGCTGACCATGGACGTGAATGTT
>probe:Drosophila_2:1634624_at:111:431; Interrogation_Position=649; Antisense; GAGTACGAACACTATGCCAATGCTA
>probe:Drosophila_2:1634624_at:495:623; Interrogation_Position=684; Antisense; TGCCGAGAAGTCACGCTACATCAAT
>probe:Drosophila_2:1634624_at:354:247; Interrogation_Position=706; Antisense; AATTCCATTGCCGAGAGGGCCAATC
>probe:Drosophila_2:1634624_at:640:441; Interrogation_Position=769; Antisense; GATGTGCTACTCCATCAAATGGCCA
>probe:Drosophila_2:1634624_at:345:191; Interrogation_Position=794; Antisense; AACTATCCGTGAGCATTCTATCCAT
>probe:Drosophila_2:1634624_at:573:527; Interrogation_Position=835; Antisense; GGGACCGATGACGACACAGAGCTTC
>probe:Drosophila_2:1634624_at:579:381; Interrogation_Position=883; Antisense; GAACCCTGCTATGAATTCGGCACCT
>probe:Drosophila_2:1634624_at:289:311; Interrogation_Position=913; Antisense; CCAACGGATGGATTTGTCGGTTCTC
>probe:Drosophila_2:1634624_at:137:575; Interrogation_Position=947; Antisense; GGCGAGATTATAGCTCCTCTTTTGA

Paste this into a BLAST search page for me
TAAGTATTTCTTTGGCCTCACTTTAAGAATTCTGTGGTACGCACTCTCAATCACCCAAGTGATTGAGCGCTCCTGGATCGATAGTCAACCCCAGGTGCTGGGTGCTGACCATGGACGTGAATGTTGAGTACGAACACTATGCCAATGCTATGCCGAGAAGTCACGCTACATCAATAATTCCATTGCCGAGAGGGCCAATCGATGTGCTACTCCATCAAATGGCCAAACTATCCGTGAGCATTCTATCCATGGGACCGATGACGACACAGAGCTTCGAACCCTGCTATGAATTCGGCACCTCCAACGGATGGATTTGTCGGTTCTCGGCGAGATTATAGCTCCTCTTTTGA

Full Affymetrix probeset data:

Annotations for 1634624_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720