Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634625_at:

>probe:Drosophila_2:1634625_at:331:493; Interrogation_Position=1515; Antisense; GTAAGTAACTTTTTGCAGCTGCTTG
>probe:Drosophila_2:1634625_at:358:353; Interrogation_Position=1529; Antisense; GCAGCTGCTTGCTTTAGAATGCCAG
>probe:Drosophila_2:1634625_at:41:233; Interrogation_Position=1546; Antisense; AATGCCAGCGAATGTTGCGTTGATT
>probe:Drosophila_2:1634625_at:54:599; Interrogation_Position=1574; Antisense; TGTACACCGATGCATTCTTTGGCCA
>probe:Drosophila_2:1634625_at:584:513; Interrogation_Position=1603; Antisense; GTGTATTTTTTACCAGTATCCAAGT
>probe:Drosophila_2:1634625_at:363:483; Interrogation_Position=1618; Antisense; GTATCCAAGTAAGCAGCACCTTCTA
>probe:Drosophila_2:1634625_at:618:351; Interrogation_Position=1630; Antisense; GCAGCACCTTCTAGTTTGAGACGTA
>probe:Drosophila_2:1634625_at:328:487; Interrogation_Position=1693; Antisense; GTACCGAGCTAGAAACTAAGTCCTT
>probe:Drosophila_2:1634625_at:167:115; Interrogation_Position=1724; Antisense; AGCATTTACGATATACCCGAAGAAT
>probe:Drosophila_2:1634625_at:62:725; Interrogation_Position=1865; Antisense; TTGACATTTACGACCATCGACCAGC
>probe:Drosophila_2:1634625_at:469:295; Interrogation_Position=1882; Antisense; CGACCAGCGCACCAATAAGATTTTA
>probe:Drosophila_2:1634625_at:106:189; Interrogation_Position=1918; Antisense; AACATCAGCAGTTTGTGTCCCTAGA
>probe:Drosophila_2:1634625_at:249:517; Interrogation_Position=1932; Antisense; GTGTCCCTAGAAACCCAGAACTGTT
>probe:Drosophila_2:1634625_at:396:381; Interrogation_Position=1949; Antisense; GAACTGTTCCCAATAAAGCTAACCG

Paste this into a BLAST search page for me
GTAAGTAACTTTTTGCAGCTGCTTGGCAGCTGCTTGCTTTAGAATGCCAGAATGCCAGCGAATGTTGCGTTGATTTGTACACCGATGCATTCTTTGGCCAGTGTATTTTTTACCAGTATCCAAGTGTATCCAAGTAAGCAGCACCTTCTAGCAGCACCTTCTAGTTTGAGACGTAGTACCGAGCTAGAAACTAAGTCCTTAGCATTTACGATATACCCGAAGAATTTGACATTTACGACCATCGACCAGCCGACCAGCGCACCAATAAGATTTTAAACATCAGCAGTTTGTGTCCCTAGAGTGTCCCTAGAAACCCAGAACTGTTGAACTGTTCCCAATAAAGCTAACCG

Full Affymetrix probeset data:

Annotations for 1634625_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime