Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634626_at:

>probe:Drosophila_2:1634626_at:695:409; Interrogation_Position=2188; Antisense; GACGACAGAGATTCACCCATGGACT
>probe:Drosophila_2:1634626_at:430:133; Interrogation_Position=2202; Antisense; ACCCATGGACTTTTTGACTTACGAT
>probe:Drosophila_2:1634626_at:108:217; Interrogation_Position=2239; Antisense; AAGTATGTTCCCTTGGCCGAAGAGA
>probe:Drosophila_2:1634626_at:200:297; Interrogation_Position=2268; Antisense; CCAACCACCCAATCGTCGAAGAAAG
>probe:Drosophila_2:1634626_at:553:691; Interrogation_Position=2309; Antisense; TTTTCGTTCCCAAAACTGACGCAGG
>probe:Drosophila_2:1634626_at:484:431; Interrogation_Position=2350; Antisense; GAGTGTGAAATTTGCTGTTCGTTGC
>probe:Drosophila_2:1634626_at:260:217; Interrogation_Position=2393; Antisense; AAGTATCACCTTTGCTAATGGAAAT
>probe:Drosophila_2:1634626_at:84:61; Interrogation_Position=2506; Antisense; AGGGAATTAATCTCCATAACTAAGC
>probe:Drosophila_2:1634626_at:480:31; Interrogation_Position=2521; Antisense; ATAACTAAGCCCAATCAAAGCGATT
>probe:Drosophila_2:1634626_at:700:601; Interrogation_Position=2582; Antisense; TGTATTCTCGTTACCCCAAAATCAT
>probe:Drosophila_2:1634626_at:137:341; Interrogation_Position=2608; Antisense; TCCGAAACCCTTGAGAACCTTACAT
>probe:Drosophila_2:1634626_at:671:169; Interrogation_Position=2670; Antisense; AAAGGCTTACAAGGCACTCGATGTG
>probe:Drosophila_2:1634626_at:130:457; Interrogation_Position=2703; Antisense; GATATCACGCTGTTATCAAACACTT
>probe:Drosophila_2:1634626_at:546:187; Interrogation_Position=2721; Antisense; AACACTTTTTGAAGCCGAGCAACGA

Paste this into a BLAST search page for me
GACGACAGAGATTCACCCATGGACTACCCATGGACTTTTTGACTTACGATAAGTATGTTCCCTTGGCCGAAGAGACCAACCACCCAATCGTCGAAGAAAGTTTTCGTTCCCAAAACTGACGCAGGGAGTGTGAAATTTGCTGTTCGTTGCAAGTATCACCTTTGCTAATGGAAATAGGGAATTAATCTCCATAACTAAGCATAACTAAGCCCAATCAAAGCGATTTGTATTCTCGTTACCCCAAAATCATTCCGAAACCCTTGAGAACCTTACATAAAGGCTTACAAGGCACTCGATGTGGATATCACGCTGTTATCAAACACTTAACACTTTTTGAAGCCGAGCAACGA

Full Affymetrix probeset data:

Annotations for 1634626_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime