FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634628_at:

>probe:Drosophila_2:1634628_at:576:491; Interrogation_Position=1005; Antisense; GTAACTGCAAGTATTCGTTTCCTAA
>probe:Drosophila_2:1634628_at:106:259; Interrogation_Position=1089; Antisense; CACAGGCTGTGCAATATTTCCAAAA
>probe:Drosophila_2:1634628_at:41:595; Interrogation_Position=573; Antisense; TGGGCAAGCATCACTCATTCCTCAT
>probe:Drosophila_2:1634628_at:251:225; Interrogation_Position=603; Antisense; AAGGAGCGCGCCTGGCTATGTACGC
>probe:Drosophila_2:1634628_at:48:341; Interrogation_Position=617; Antisense; GCTATGTACGCGATGCCCACTAGGG
>probe:Drosophila_2:1634628_at:80:653; Interrogation_Position=651; Antisense; TCAAGAAAGTGTGCTCCGATGTCGA
>probe:Drosophila_2:1634628_at:35:215; Interrogation_Position=684; Antisense; AAGAGAACCTGCCTTCCATGCTGAA
>probe:Drosophila_2:1634628_at:258:145; Interrogation_Position=723; Antisense; ACTACGATCGCACAGAAGACCTCTA
>probe:Drosophila_2:1634628_at:506:109; Interrogation_Position=736; Antisense; AGAAGACCTCTACACGCTATACGAT
>probe:Drosophila_2:1634628_at:38:687; Interrogation_Position=753; Antisense; TATACGATCTACACAGCCTGCCTTA
>probe:Drosophila_2:1634628_at:638:123; Interrogation_Position=767; Antisense; AGCCTGCCTTAGAATCCATACATAC
>probe:Drosophila_2:1634628_at:317:725; Interrogation_Position=924; Antisense; TTGTACTGTATCTAACTCTCTATCA
>probe:Drosophila_2:1634628_at:119:643; Interrogation_Position=940; Antisense; TCTCTATCAGATCTGGTGTCTACCC
>probe:Drosophila_2:1634628_at:401:671; Interrogation_Position=960; Antisense; TACCCCGGCGTAGATTATGTAGCTA

Paste this into a BLAST search page for me
GTAACTGCAAGTATTCGTTTCCTAACACAGGCTGTGCAATATTTCCAAAATGGGCAAGCATCACTCATTCCTCATAAGGAGCGCGCCTGGCTATGTACGCGCTATGTACGCGATGCCCACTAGGGTCAAGAAAGTGTGCTCCGATGTCGAAAGAGAACCTGCCTTCCATGCTGAAACTACGATCGCACAGAAGACCTCTAAGAAGACCTCTACACGCTATACGATTATACGATCTACACAGCCTGCCTTAAGCCTGCCTTAGAATCCATACATACTTGTACTGTATCTAACTCTCTATCATCTCTATCAGATCTGGTGTCTACCCTACCCCGGCGTAGATTATGTAGCTA

Full Affymetrix probeset data:

Annotations for 1634628_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720