Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634629_at:

>probe:Drosophila_2:1634629_at:123:423; Interrogation_Position=1239; Antisense; GAGAAGCATCCCGACAGAACCCAGA
>probe:Drosophila_2:1634629_at:477:127; Interrogation_Position=1284; Antisense; ACCAGTGGCTGTAAGTCCGACGGCT
>probe:Drosophila_2:1634629_at:359:569; Interrogation_Position=1305; Antisense; GGCTCTTCAACACCCATTTGGAGAA
>probe:Drosophila_2:1634629_at:186:715; Interrogation_Position=1370; Antisense; TTCTGACTCTTTCAATTCCTCCAAT
>probe:Drosophila_2:1634629_at:92:501; Interrogation_Position=1411; Antisense; GTCTGGCCAGCGATTCTCAAGAAAA
>probe:Drosophila_2:1634629_at:609:179; Interrogation_Position=1429; Antisense; AAGAAAACCACGAGCTGTCCACGGC
>probe:Drosophila_2:1634629_at:498:611; Interrogation_Position=1462; Antisense; TGACGGCGGCCTTTATGCGGCGACA
>probe:Drosophila_2:1634629_at:244:211; Interrogation_Position=1520; Antisense; AAGACGGTATCTACGTTAGCCACGT
>probe:Drosophila_2:1634629_at:525:673; Interrogation_Position=1536; Antisense; TAGCCACGTCGTAGCTCGGGTCGTA
>probe:Drosophila_2:1634629_at:149:337; Interrogation_Position=1564; Antisense; GCTGCGACAGCAAGTTCTCTAAATT
>probe:Drosophila_2:1634629_at:212:243; Interrogation_Position=1670; Antisense; AATTTGCGGCTATCGATTACAACTA
>probe:Drosophila_2:1634629_at:651:23; Interrogation_Position=1698; Antisense; ATATCGCCGATGTGCAATGCTCTTG
>probe:Drosophila_2:1634629_at:117:231; Interrogation_Position=1713; Antisense; AATGCTCTTGAACGCTAACCAACAC
>probe:Drosophila_2:1634629_at:508:187; Interrogation_Position=1733; Antisense; AACACTGTCAGTTTACCGCACACAT

Paste this into a BLAST search page for me
GAGAAGCATCCCGACAGAACCCAGAACCAGTGGCTGTAAGTCCGACGGCTGGCTCTTCAACACCCATTTGGAGAATTCTGACTCTTTCAATTCCTCCAATGTCTGGCCAGCGATTCTCAAGAAAAAAGAAAACCACGAGCTGTCCACGGCTGACGGCGGCCTTTATGCGGCGACAAAGACGGTATCTACGTTAGCCACGTTAGCCACGTCGTAGCTCGGGTCGTAGCTGCGACAGCAAGTTCTCTAAATTAATTTGCGGCTATCGATTACAACTAATATCGCCGATGTGCAATGCTCTTGAATGCTCTTGAACGCTAACCAACACAACACTGTCAGTTTACCGCACACAT

Full Affymetrix probeset data:

Annotations for 1634629_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime