Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634630_at:

>probe:Drosophila_2:1634630_at:289:513; Interrogation_Position=1019; Antisense; GTGATTGGCATCCTCAGGGAGAACA
>probe:Drosophila_2:1634630_at:236:267; Interrogation_Position=1033; Antisense; CAGGGAGAACAACCCGCACTTCGAG
>probe:Drosophila_2:1634630_at:408:717; Interrogation_Position=1052; Antisense; TTCGAGCTCCACGAAGTGCAGGGCA
>probe:Drosophila_2:1634630_at:306:139; Interrogation_Position=1083; Antisense; ACGTTCACCTCAACAATGCGCAGGG
>probe:Drosophila_2:1634630_at:70:533; Interrogation_Position=1106; Antisense; GGTGTGGCGGCCGTCATTAATCCCT
>probe:Drosophila_2:1634630_at:577:321; Interrogation_Position=1146; Antisense; GCCCACCGCATCTGGAGAACTGGAC
>probe:Drosophila_2:1634630_at:160:609; Interrogation_Position=1194; Antisense; TGCCCGAGGTCGTCAAGGAATTCAA
>probe:Drosophila_2:1634630_at:337:173; Interrogation_Position=1263; Antisense; AAAGCAACCTATAGCTGCTGCCAGC
>probe:Drosophila_2:1634630_at:190:337; Interrogation_Position=1279; Antisense; GCTGCCAGCATCTCTGAGATTCAGT
>probe:Drosophila_2:1634630_at:649:461; Interrogation_Position=1296; Antisense; GATTCAGTCAGCAGCGCGATGCGAA
>probe:Drosophila_2:1634630_at:117:605; Interrogation_Position=1345; Antisense; TGATTTCATTATGCCGACGTGATGC
>probe:Drosophila_2:1634630_at:653:407; Interrogation_Position=1360; Antisense; GACGTGATGCTTTCTTCAAGCCTTA
>probe:Drosophila_2:1634630_at:122:371; Interrogation_Position=955; Antisense; GAATGTGCCCTACTGCGTGATCAAG
>probe:Drosophila_2:1634630_at:650:653; Interrogation_Position=975; Antisense; TCAAGGGCTCCGAGTCGAACTACAT

Paste this into a BLAST search page for me
GTGATTGGCATCCTCAGGGAGAACACAGGGAGAACAACCCGCACTTCGAGTTCGAGCTCCACGAAGTGCAGGGCAACGTTCACCTCAACAATGCGCAGGGGGTGTGGCGGCCGTCATTAATCCCTGCCCACCGCATCTGGAGAACTGGACTGCCCGAGGTCGTCAAGGAATTCAAAAAGCAACCTATAGCTGCTGCCAGCGCTGCCAGCATCTCTGAGATTCAGTGATTCAGTCAGCAGCGCGATGCGAATGATTTCATTATGCCGACGTGATGCGACGTGATGCTTTCTTCAAGCCTTAGAATGTGCCCTACTGCGTGATCAAGTCAAGGGCTCCGAGTCGAACTACAT

Full Affymetrix probeset data:

Annotations for 1634630_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime