Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634631_at:

>probe:Drosophila_2:1634631_at:231:511; Interrogation_Position=2620; Antisense; GTGAATCCCTCTACTTTCAGTTTCT
>probe:Drosophila_2:1634631_at:523:479; Interrogation_Position=2639; Antisense; GTTTCTCGTGGATAGTGCCGTGCAA
>probe:Drosophila_2:1634631_at:354:367; Interrogation_Position=2682; Antisense; GAATCTGTATTTTTCCGGCTACCTA
>probe:Drosophila_2:1634631_at:389:685; Interrogation_Position=2705; Antisense; TATACTCCAGTACTTCGGTGCTGTC
>probe:Drosophila_2:1634631_at:131:147; Interrogation_Position=2731; Antisense; ACTATTTCACCGCAGGAGAGCTTCT
>probe:Drosophila_2:1634631_at:711:55; Interrogation_Position=2789; Antisense; ATGACGCCAGATTAGCATCCCACAG
>probe:Drosophila_2:1634631_at:281:229; Interrogation_Position=2856; Antisense; AATGGACACTCTTTACGCGAAACAG
>probe:Drosophila_2:1634631_at:725:93; Interrogation_Position=2879; Antisense; AGTTCCAGCTAAACACCTCAGTGAG
>probe:Drosophila_2:1634631_at:242:435; Interrogation_Position=2916; Antisense; GAGGGTCTCGTTACCTGACTCAAGC
>probe:Drosophila_2:1634631_at:710:163; Interrogation_Position=2948; Antisense; AAATCGGCGGTTCAATATGCTCCTC
>probe:Drosophila_2:1634631_at:330:653; Interrogation_Position=2993; Antisense; TCAAGAACAAGCTTCAGCCCTGCGT
>probe:Drosophila_2:1634631_at:195:283; Interrogation_Position=3012; Antisense; CTGCGTCTCCACTTATAACGTAGTT
>probe:Drosophila_2:1634631_at:211:485; Interrogation_Position=3031; Antisense; GTAGTTAGTCTGCACGACGTGAGCA
>probe:Drosophila_2:1634631_at:225:371; Interrogation_Position=3083; Antisense; GAAGTTCGAAATCCGTTGTGTACAT

Paste this into a BLAST search page for me
GTGAATCCCTCTACTTTCAGTTTCTGTTTCTCGTGGATAGTGCCGTGCAAGAATCTGTATTTTTCCGGCTACCTATATACTCCAGTACTTCGGTGCTGTCACTATTTCACCGCAGGAGAGCTTCTATGACGCCAGATTAGCATCCCACAGAATGGACACTCTTTACGCGAAACAGAGTTCCAGCTAAACACCTCAGTGAGGAGGGTCTCGTTACCTGACTCAAGCAAATCGGCGGTTCAATATGCTCCTCTCAAGAACAAGCTTCAGCCCTGCGTCTGCGTCTCCACTTATAACGTAGTTGTAGTTAGTCTGCACGACGTGAGCAGAAGTTCGAAATCCGTTGTGTACAT

Full Affymetrix probeset data:

Annotations for 1634631_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime