FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634632_at:

>probe:Drosophila_2:1634632_at:362:605; Interrogation_Position=227; Antisense; TGATCGTTATCACACAGCCATCGAC
>probe:Drosophila_2:1634632_at:435:89; Interrogation_Position=331; Antisense; AGTACGGGTCGCTCACTGCAGGAGA
>probe:Drosophila_2:1634632_at:252:77; Interrogation_Position=350; Antisense; AGGAGAGTGTGCATCGCCAGCAGCC
>probe:Drosophila_2:1634632_at:86:545; Interrogation_Position=378; Antisense; GGATGACGATGAGGCCCAGGAAACC
>probe:Drosophila_2:1634632_at:271:71; Interrogation_Position=395; Antisense; AGGAAACCGGCGTGACCACACTGAC
>probe:Drosophila_2:1634632_at:302:285; Interrogation_Position=415; Antisense; CTGACTGGCCGGGTGCTCGATGATC
>probe:Drosophila_2:1634632_at:199:59; Interrogation_Position=434; Antisense; ATGATCGCCTGGATCTTCCGGATGG
>probe:Drosophila_2:1634632_at:179:417; Interrogation_Position=466; Antisense; GAGCCGCAGGAATTGGTGACCCACA
>probe:Drosophila_2:1634632_at:426:109; Interrogation_Position=563; Antisense; AGAAGACCCATCGACGGGTGCACAA
>probe:Drosophila_2:1634632_at:218:533; Interrogation_Position=579; Antisense; GGTGCACAAGCATCCCCAGAAAAAG
>probe:Drosophila_2:1634632_at:164:89; Interrogation_Position=638; Antisense; AGTCGGCGGCGAATCAGCAACGCAA
>probe:Drosophila_2:1634632_at:538:551; Interrogation_Position=666; Antisense; GGAGCCCGCGGTAAACTTCATCGAA
>probe:Drosophila_2:1634632_at:551:673; Interrogation_Position=694; Antisense; TACCATCAAGATCGAGGCCAATCCC
>probe:Drosophila_2:1634632_at:183:463; Interrogation_Position=742; Antisense; GATTCTCGATTGCAGCGCATCTGGC

Paste this into a BLAST search page for me
TGATCGTTATCACACAGCCATCGACAGTACGGGTCGCTCACTGCAGGAGAAGGAGAGTGTGCATCGCCAGCAGCCGGATGACGATGAGGCCCAGGAAACCAGGAAACCGGCGTGACCACACTGACCTGACTGGCCGGGTGCTCGATGATCATGATCGCCTGGATCTTCCGGATGGGAGCCGCAGGAATTGGTGACCCACAAGAAGACCCATCGACGGGTGCACAAGGTGCACAAGCATCCCCAGAAAAAGAGTCGGCGGCGAATCAGCAACGCAAGGAGCCCGCGGTAAACTTCATCGAATACCATCAAGATCGAGGCCAATCCCGATTCTCGATTGCAGCGCATCTGGC

Full Affymetrix probeset data:

Annotations for 1634632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720