FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634636_at:

>probe:Drosophila_2:1634636_at:525:507; Interrogation_Position=159; Antisense; GTGCTGCACTTTGGCTATTGGCGCT
>probe:Drosophila_2:1634636_at:578:297; Interrogation_Position=180; Antisense; CGCTCTTTTGTGTCTGGGATTCGCA
>probe:Drosophila_2:1634636_at:447:353; Interrogation_Position=202; Antisense; GCAGCCCTCATTCAAGCTCAGGATA
>probe:Drosophila_2:1634636_at:699:659; Interrogation_Position=225; Antisense; TAAGCCGGTGACTGATGTGTGCCTG
>probe:Drosophila_2:1634636_at:546:53; Interrogation_Position=252; Antisense; ATGCATCTGCGAGGCCATCAGTGGA
>probe:Drosophila_2:1634636_at:489:445; Interrogation_Position=275; Antisense; GATGCAACCAGACACGTTACTGCGG
>probe:Drosophila_2:1634636_at:120:603; Interrogation_Position=317; Antisense; TGTTTCGCATCACCTGGGCATATTG
>probe:Drosophila_2:1634636_at:230:547; Interrogation_Position=390; Antisense; GGATGCGTATGCCAATTGCGTGAAC
>probe:Drosophila_2:1634636_at:522:151; Interrogation_Position=449; Antisense; ACATGACCAAGTTCGGCCAGGACTG
>probe:Drosophila_2:1634636_at:268:201; Interrogation_Position=484; Antisense; AACGCCATCGATTGCTACGACTTTG
>probe:Drosophila_2:1634636_at:651:417; Interrogation_Position=547; Antisense; GAGCTGAGCTACCAGTACCAGACGC
>probe:Drosophila_2:1634636_at:483:101; Interrogation_Position=572; Antisense; AGCTGACCAACTGCCTTAATTCGTT
>probe:Drosophila_2:1634636_at:611:245; Interrogation_Position=589; Antisense; AATTCGTTCCAGCAGATCGACGTGC
>probe:Drosophila_2:1634636_at:171:451; Interrogation_Position=603; Antisense; GATCGACGTGCGCTCTAGCATATAA

Paste this into a BLAST search page for me
GTGCTGCACTTTGGCTATTGGCGCTCGCTCTTTTGTGTCTGGGATTCGCAGCAGCCCTCATTCAAGCTCAGGATATAAGCCGGTGACTGATGTGTGCCTGATGCATCTGCGAGGCCATCAGTGGAGATGCAACCAGACACGTTACTGCGGTGTTTCGCATCACCTGGGCATATTGGGATGCGTATGCCAATTGCGTGAACACATGACCAAGTTCGGCCAGGACTGAACGCCATCGATTGCTACGACTTTGGAGCTGAGCTACCAGTACCAGACGCAGCTGACCAACTGCCTTAATTCGTTAATTCGTTCCAGCAGATCGACGTGCGATCGACGTGCGCTCTAGCATATAA

Full Affymetrix probeset data:

Annotations for 1634636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720