Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634637_a_at:

>probe:Drosophila_2:1634637_a_at:211:725; Interrogation_Position=211; Antisense; TTGTCAAGACCGATCTGCAAGTGCA
>probe:Drosophila_2:1634637_a_at:682:303; Interrogation_Position=274; Antisense; CCGGGCTGGCGGTGAAGAACTTCAT
>probe:Drosophila_2:1634637_a_at:122:383; Interrogation_Position=290; Antisense; GAACTTCATTGATGTGGGCGCCGGT
>probe:Drosophila_2:1634637_a_at:489:543; Interrogation_Position=326; Antisense; GGATTATCGCGGCAATCTCGGCGTC
>probe:Drosophila_2:1634637_a_at:482:501; Interrogation_Position=348; Antisense; GTCGTCCTGTTCAATCACTCAGATG
>probe:Drosophila_2:1634637_a_at:692:635; Interrogation_Position=379; Antisense; TCGAGGTGAAGCATGGCGACCGCAT
>probe:Drosophila_2:1634637_a_at:427:473; Interrogation_Position=410; Antisense; GTTCATTTGCGAGCGTATCTTCTAT
>probe:Drosophila_2:1634637_a_at:643:37; Interrogation_Position=426; Antisense; ATCTTCTATCCGCAACTGGTGATGG
>probe:Drosophila_2:1634637_a_at:486:461; Interrogation_Position=487; Antisense; GATTCGGTTCCACCGGAGTCAAGGA
>probe:Drosophila_2:1634637_a_at:343:431; Interrogation_Position=502; Antisense; GAGTCAAGGATCTGCCGGCAGCCAA
>probe:Drosophila_2:1634637_a_at:54:251; Interrogation_Position=577; Antisense; CGGCTCCTGTTGCTACGTAAACGAG
>probe:Drosophila_2:1634637_a_at:44:199; Interrogation_Position=596; Antisense; AACGAGGAACTATTGCCGCATTCTT
>probe:Drosophila_2:1634637_a_at:540:11; Interrogation_Position=615; Antisense; ATTCTTAATCCCTTCATGGTCACTA
>probe:Drosophila_2:1634637_a_at:389:429; Interrogation_Position=645; Antisense; GAGTTTCATTCTGTATCCTTAAGTG

Paste this into a BLAST search page for me
TTGTCAAGACCGATCTGCAAGTGCACCGGGCTGGCGGTGAAGAACTTCATGAACTTCATTGATGTGGGCGCCGGTGGATTATCGCGGCAATCTCGGCGTCGTCGTCCTGTTCAATCACTCAGATGTCGAGGTGAAGCATGGCGACCGCATGTTCATTTGCGAGCGTATCTTCTATATCTTCTATCCGCAACTGGTGATGGGATTCGGTTCCACCGGAGTCAAGGAGAGTCAAGGATCTGCCGGCAGCCAACGGCTCCTGTTGCTACGTAAACGAGAACGAGGAACTATTGCCGCATTCTTATTCTTAATCCCTTCATGGTCACTAGAGTTTCATTCTGTATCCTTAAGTG

Full Affymetrix probeset data:

Annotations for 1634637_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime