FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634638_at:

>probe:Drosophila_2:1634638_at:481:129; Interrogation_Position=392; Antisense; ACCTGGTGAATACAGTGAGTACTCC
>probe:Drosophila_2:1634638_at:580:259; Interrogation_Position=416; Antisense; CACGGCACGGATGGAACGGCTTTTT
>probe:Drosophila_2:1634638_at:364:383; Interrogation_Position=429; Antisense; GAACGGCTTTTTGCGTAATTGCCAG
>probe:Drosophila_2:1634638_at:485:247; Interrogation_Position=445; Antisense; AATTGCCAGAGTTCACTACTGCGTC
>probe:Drosophila_2:1634638_at:713:427; Interrogation_Position=453; Antisense; GAGTTCACTACTGCGTCATTAATGA
>probe:Drosophila_2:1634638_at:542:273; Interrogation_Position=469; Antisense; CATTAATGAAAATTGCCGCCGCACG
>probe:Drosophila_2:1634638_at:692:161; Interrogation_Position=478; Antisense; AAATTGCCGCCGCACGTATACGTAT
>probe:Drosophila_2:1634638_at:418:349; Interrogation_Position=489; Antisense; GCACGTATACGTATTATTCGGTTTA
>probe:Drosophila_2:1634638_at:710:491; Interrogation_Position=517; Antisense; GTAAAAACAAATCTGCTGCCGCATA
>probe:Drosophila_2:1634638_at:471:621; Interrogation_Position=530; Antisense; TGCTGCCGCATAGAGCGATTCTATA
>probe:Drosophila_2:1634638_at:724:11; Interrogation_Position=547; Antisense; ATTCTATACACGCTCCATTGCTGGT
>probe:Drosophila_2:1634638_at:143:275; Interrogation_Position=562; Antisense; CATTGCTGGTTTTTTGCTTTCGGTA
>probe:Drosophila_2:1634638_at:603:341; Interrogation_Position=577; Antisense; GCTTTCGGTATTTGTATTTACTTGG
>probe:Drosophila_2:1634638_at:436:691; Interrogation_Position=593; Antisense; TTTACTTGGCTTGTCATTGTTTATG

Paste this into a BLAST search page for me
ACCTGGTGAATACAGTGAGTACTCCCACGGCACGGATGGAACGGCTTTTTGAACGGCTTTTTGCGTAATTGCCAGAATTGCCAGAGTTCACTACTGCGTCGAGTTCACTACTGCGTCATTAATGACATTAATGAAAATTGCCGCCGCACGAAATTGCCGCCGCACGTATACGTATGCACGTATACGTATTATTCGGTTTAGTAAAAACAAATCTGCTGCCGCATATGCTGCCGCATAGAGCGATTCTATAATTCTATACACGCTCCATTGCTGGTCATTGCTGGTTTTTTGCTTTCGGTAGCTTTCGGTATTTGTATTTACTTGGTTTACTTGGCTTGTCATTGTTTATG

Full Affymetrix probeset data:

Annotations for 1634638_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720