FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634640_at:

>probe:Drosophila_2:1634640_at:210:165; Interrogation_Position=1089; Antisense; AAATCTTCCCGAGGACAGCGATGAC
>probe:Drosophila_2:1634640_at:652:609; Interrogation_Position=1110; Antisense; TGACATCAGTATGTTTCAGTTCAAC
>probe:Drosophila_2:1634640_at:160:193; Interrogation_Position=1136; Antisense; AACTAGTCTACTTGGAATGTGTGAT
>probe:Drosophila_2:1634640_at:460:421; Interrogation_Position=1173; Antisense; GAGAATGTTTCCATCAGTGCCATTT
>probe:Drosophila_2:1634640_at:21:647; Interrogation_Position=1186; Antisense; TCAGTGCCATTTATTGGGCGCCAAT
>probe:Drosophila_2:1634640_at:513:447; Interrogation_Position=1242; Antisense; GATGCCAAAGGACACCCAGATCAGC
>probe:Drosophila_2:1634640_at:30:427; Interrogation_Position=1287; Antisense; GAGAGATCCGCGACATTTCCCGAAA
>probe:Drosophila_2:1634640_at:447:695; Interrogation_Position=1302; Antisense; TTTCCCGAAACCAGATCTGTTCCAG
>probe:Drosophila_2:1634640_at:641:719; Interrogation_Position=1321; Antisense; TTCCAGCCAGACAGATTTCTACCGG
>probe:Drosophila_2:1634640_at:656:85; Interrogation_Position=1353; Antisense; AGTGAATCGTCATCCTTTTGCATAT
>probe:Drosophila_2:1634640_at:462:497; Interrogation_Position=1361; Antisense; GTCATCCTTTTGCATATGTGCCTTT
>probe:Drosophila_2:1634640_at:102:63; Interrogation_Position=1376; Antisense; ATGTGCCTTTTAGTGCAGGCCAGAG
>probe:Drosophila_2:1634640_at:690:691; Interrogation_Position=1420; Antisense; TTTGCCATTCTGGAGATGAAGGTGC
>probe:Drosophila_2:1634640_at:212:197; Interrogation_Position=1513; Antisense; AACGGAATCGTGCTGCGCACACAAG

Paste this into a BLAST search page for me
AAATCTTCCCGAGGACAGCGATGACTGACATCAGTATGTTTCAGTTCAACAACTAGTCTACTTGGAATGTGTGATGAGAATGTTTCCATCAGTGCCATTTTCAGTGCCATTTATTGGGCGCCAATGATGCCAAAGGACACCCAGATCAGCGAGAGATCCGCGACATTTCCCGAAATTTCCCGAAACCAGATCTGTTCCAGTTCCAGCCAGACAGATTTCTACCGGAGTGAATCGTCATCCTTTTGCATATGTCATCCTTTTGCATATGTGCCTTTATGTGCCTTTTAGTGCAGGCCAGAGTTTGCCATTCTGGAGATGAAGGTGCAACGGAATCGTGCTGCGCACACAAG

Full Affymetrix probeset data:

Annotations for 1634640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720