Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634643_at:

>probe:Drosophila_2:1634643_at:693:533; Interrogation_Position=1816; Antisense; GGTGATTGTCATTTCTGGTGTCAAA
>probe:Drosophila_2:1634643_at:240:161; Interrogation_Position=1838; Antisense; AAATATTGTTGCACAGCGGAACTGT
>probe:Drosophila_2:1634643_at:324:591; Interrogation_Position=1874; Antisense; TGGTCACAGCCGTTTTCTACCCATA
>probe:Drosophila_2:1634643_at:470:659; Interrogation_Position=1897; Antisense; TAACTCTCCGCCCAAAAACTGTAAT
>probe:Drosophila_2:1634643_at:727:19; Interrogation_Position=1942; Antisense; ATATTTTGCCGGCAAGGTGACGCCT
>probe:Drosophila_2:1634643_at:515:583; Interrogation_Position=1994; Antisense; TGGCTGCACTTGTCGCGGCTCAAAA
>probe:Drosophila_2:1634643_at:232:571; Interrogation_Position=2010; Antisense; GGCTCAAAATCCACTGCCCAAATGG
>probe:Drosophila_2:1634643_at:46:179; Interrogation_Position=2044; Antisense; AAACTGGCAACCTGCAACTGGCAAT
>probe:Drosophila_2:1634643_at:606:583; Interrogation_Position=2076; Antisense; TGGCAGCCGGCCAAAGTTGCAACTG
>probe:Drosophila_2:1634643_at:124:171; Interrogation_Position=2088; Antisense; AAAGTTGCAACTGCCTCCGAAGGTG
>probe:Drosophila_2:1634643_at:112:373; Interrogation_Position=2106; Antisense; GAAGGTGTCTTCGATTATTGCCAAA
>probe:Drosophila_2:1634643_at:280:191; Interrogation_Position=2129; Antisense; AACATTAATTATTTGCGCGCGATTT
>probe:Drosophila_2:1634643_at:473:229; Interrogation_Position=2200; Antisense; AATGTTTATTTTTCTGCTCTCCCTG
>probe:Drosophila_2:1634643_at:560:337; Interrogation_Position=2215; Antisense; GCTCTCCCTGGTGTATCTTTGATTA

Paste this into a BLAST search page for me
GGTGATTGTCATTTCTGGTGTCAAAAAATATTGTTGCACAGCGGAACTGTTGGTCACAGCCGTTTTCTACCCATATAACTCTCCGCCCAAAAACTGTAATATATTTTGCCGGCAAGGTGACGCCTTGGCTGCACTTGTCGCGGCTCAAAAGGCTCAAAATCCACTGCCCAAATGGAAACTGGCAACCTGCAACTGGCAATTGGCAGCCGGCCAAAGTTGCAACTGAAAGTTGCAACTGCCTCCGAAGGTGGAAGGTGTCTTCGATTATTGCCAAAAACATTAATTATTTGCGCGCGATTTAATGTTTATTTTTCTGCTCTCCCTGGCTCTCCCTGGTGTATCTTTGATTA

Full Affymetrix probeset data:

Annotations for 1634643_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime