FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634645_at:

>probe:Drosophila_2:1634645_at:112:377; Interrogation_Position=429; Antisense; GAAGCCTTCCTTGCCAGAAGTTAGT
>probe:Drosophila_2:1634645_at:433:23; Interrogation_Position=471; Antisense; ATATCGTCTGAGTATGCCACGCTGG
>probe:Drosophila_2:1634645_at:652:565; Interrogation_Position=494; Antisense; GGCAGCGCCAAAAGTATATCCCACC
>probe:Drosophila_2:1634645_at:416:91; Interrogation_Position=530; Antisense; AGTTTCCCTATCGACCACAAATCAT
>probe:Drosophila_2:1634645_at:397:165; Interrogation_Position=548; Antisense; AAATCATCGGTCAAAGTGCTCCTCC
>probe:Drosophila_2:1634645_at:481:169; Interrogation_Position=599; Antisense; AAAGGCCAGTGGTTCCGTGCTGCTT
>probe:Drosophila_2:1634645_at:493:191; Interrogation_Position=658; Antisense; AACTTGCGGTTTCCTGTGTCGCGGA
>probe:Drosophila_2:1634645_at:714:259; Interrogation_Position=692; Antisense; CAGCCCGTCCCAGTAAGAAGATCTA
>probe:Drosophila_2:1634645_at:706:107; Interrogation_Position=707; Antisense; AGAAGATCTATGAACTGGCCCGGCC
>probe:Drosophila_2:1634645_at:253:475; Interrogation_Position=782; Antisense; GGGAGGTGCCCAGACTTCGGAAAAT
>probe:Drosophila_2:1634645_at:561:549; Interrogation_Position=816; Antisense; GGAGTGGCGACATCATCTGCAGCGA
>probe:Drosophila_2:1634645_at:159:647; Interrogation_Position=828; Antisense; TCATCTGCAGCGACTAGAGTTCCTA
>probe:Drosophila_2:1634645_at:635:463; Interrogation_Position=846; Antisense; GTTCCTAGCAAAACCAAATCCTCGG
>probe:Drosophila_2:1634645_at:424:459; Interrogation_Position=880; Antisense; GATTTACTGTGCTGCTGTCACTAAA

Paste this into a BLAST search page for me
GAAGCCTTCCTTGCCAGAAGTTAGTATATCGTCTGAGTATGCCACGCTGGGGCAGCGCCAAAAGTATATCCCACCAGTTTCCCTATCGACCACAAATCATAAATCATCGGTCAAAGTGCTCCTCCAAAGGCCAGTGGTTCCGTGCTGCTTAACTTGCGGTTTCCTGTGTCGCGGACAGCCCGTCCCAGTAAGAAGATCTAAGAAGATCTATGAACTGGCCCGGCCGGGAGGTGCCCAGACTTCGGAAAATGGAGTGGCGACATCATCTGCAGCGATCATCTGCAGCGACTAGAGTTCCTAGTTCCTAGCAAAACCAAATCCTCGGGATTTACTGTGCTGCTGTCACTAAA

Full Affymetrix probeset data:

Annotations for 1634645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720