FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634647_at:

>probe:Drosophila_2:1634647_at:545:115; Interrogation_Position=1190; Antisense; AGCATCGTATGCAGCGCTATCGCGA
>probe:Drosophila_2:1634647_at:550:683; Interrogation_Position=1207; Antisense; TATCGCGAGCGCCAGCTAGAAGTTC
>probe:Drosophila_2:1634647_at:238:153; Interrogation_Position=1332; Antisense; ACAGGCAGCATCTGGAGCGGACTCA
>probe:Drosophila_2:1634647_at:601:399; Interrogation_Position=1379; Antisense; GACAGTCTCGTTCTCGGAGTCGAAC
>probe:Drosophila_2:1634647_at:561:87; Interrogation_Position=1396; Antisense; AGTCGAACTCGCAGCGGGTCCAGTT
>probe:Drosophila_2:1634647_at:414:167; Interrogation_Position=1464; Antisense; AAAGTCTGGTTCTCGGTCTGGTAGC
>probe:Drosophila_2:1634647_at:372:675; Interrogation_Position=1485; Antisense; TAGCGGCTCCAGATCACGCACAAAT
>probe:Drosophila_2:1634647_at:559:161; Interrogation_Position=1506; Antisense; AAATTCGCCGGCAGGATCCCAGAAA
>probe:Drosophila_2:1634647_at:618:95; Interrogation_Position=1540; Antisense; AGATCGAGATCGGTATCACGTTCCC
>probe:Drosophila_2:1634647_at:310:535; Interrogation_Position=1589; Antisense; GGTCGCGTTCTAGGTCGAGATCCAA
>probe:Drosophila_2:1634647_at:711:667; Interrogation_Position=1599; Antisense; TAGGTCGAGATCCAAGTCCGGTTCC
>probe:Drosophila_2:1634647_at:453:97; Interrogation_Position=1642; Antisense; AGATCTGGCTCTGGGTCGCGATCGC
>probe:Drosophila_2:1634647_at:538:83; Interrogation_Position=1681; Antisense; AGTGGCTCGCCTTCTGGTTCAGGAT
>probe:Drosophila_2:1634647_at:269:449; Interrogation_Position=1703; Antisense; GATCCAGCTCTGGAAGCGCCTCAGA

Paste this into a BLAST search page for me
AGCATCGTATGCAGCGCTATCGCGATATCGCGAGCGCCAGCTAGAAGTTCACAGGCAGCATCTGGAGCGGACTCAGACAGTCTCGTTCTCGGAGTCGAACAGTCGAACTCGCAGCGGGTCCAGTTAAAGTCTGGTTCTCGGTCTGGTAGCTAGCGGCTCCAGATCACGCACAAATAAATTCGCCGGCAGGATCCCAGAAAAGATCGAGATCGGTATCACGTTCCCGGTCGCGTTCTAGGTCGAGATCCAATAGGTCGAGATCCAAGTCCGGTTCCAGATCTGGCTCTGGGTCGCGATCGCAGTGGCTCGCCTTCTGGTTCAGGATGATCCAGCTCTGGAAGCGCCTCAGA

Full Affymetrix probeset data:

Annotations for 1634647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720