FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634648_at:

>probe:Drosophila_2:1634648_at:724:99; Interrogation_Position=129; Antisense; AGAGGAGGGCTACACCAGCGCCTAC
>probe:Drosophila_2:1634648_at:578:61; Interrogation_Position=13; Antisense; ATGTGCAAGATCCTTCCTCTTTTCG
>probe:Drosophila_2:1634648_at:38:129; Interrogation_Position=142; Antisense; ACCAGCGCCTACGTGGGAGCAGATG
>probe:Drosophila_2:1634648_at:278:421; Interrogation_Position=158; Antisense; GAGCAGATGGTATATCTCGCAACGA
>probe:Drosophila_2:1634648_at:35:339; Interrogation_Position=220; Antisense; GCTCTGGAGGTGAAGGGATCCTACA
>probe:Drosophila_2:1634648_at:18:107; Interrogation_Position=296; Antisense; AGAACGGATTTGTTCCCTACGGCAG
>probe:Drosophila_2:1634648_at:327:645; Interrogation_Position=30; Antisense; TCTTTTCGTCCTGGCGGTCATGGTG
>probe:Drosophila_2:1634648_at:172:569; Interrogation_Position=316; Antisense; GGCAGCATTATCAATCCGGAAATCA
>probe:Drosophila_2:1634648_at:680:395; Interrogation_Position=334; Antisense; GAAATCACGGCCGTTGCCGAAGCAG
>probe:Drosophila_2:1634648_at:538:319; Interrogation_Position=349; Antisense; GCCGAAGCAGCCAAGGATCTGCCAA
>probe:Drosophila_2:1634648_at:299:497; Interrogation_Position=46; Antisense; GTCATGGTGGCCTGTGGTCAAGCTC
>probe:Drosophila_2:1634648_at:409:595; Interrogation_Position=58; Antisense; TGTGGTCAAGCTCTTCCCGTAGATC
>probe:Drosophila_2:1634648_at:450:471; Interrogation_Position=76; Antisense; GTAGATCCCGAACGTGAACCCGTGG
>probe:Drosophila_2:1634648_at:503:521; Interrogation_Position=97; Antisense; GTGGCTATCCTGAAGTCCGAGATCA

Paste this into a BLAST search page for me
AGAGGAGGGCTACACCAGCGCCTACATGTGCAAGATCCTTCCTCTTTTCGACCAGCGCCTACGTGGGAGCAGATGGAGCAGATGGTATATCTCGCAACGAGCTCTGGAGGTGAAGGGATCCTACAAGAACGGATTTGTTCCCTACGGCAGTCTTTTCGTCCTGGCGGTCATGGTGGGCAGCATTATCAATCCGGAAATCAGAAATCACGGCCGTTGCCGAAGCAGGCCGAAGCAGCCAAGGATCTGCCAAGTCATGGTGGCCTGTGGTCAAGCTCTGTGGTCAAGCTCTTCCCGTAGATCGTAGATCCCGAACGTGAACCCGTGGGTGGCTATCCTGAAGTCCGAGATCA

Full Affymetrix probeset data:

Annotations for 1634648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720