FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634649_at:

>probe:Drosophila_2:1634649_at:119:145; Interrogation_Position=3453; Antisense; ACTGCAATATAGCTGTATGTATTCA
>probe:Drosophila_2:1634649_at:586:493; Interrogation_Position=3481; Antisense; GTCAGAATTGGGATACTTAACTAAT
>probe:Drosophila_2:1634649_at:375:29; Interrogation_Position=3493; Antisense; ATACTTAACTAATCTGCTACCCTCC
>probe:Drosophila_2:1634649_at:404:653; Interrogation_Position=3502; Antisense; TAATCTGCTACCCTCCCAAAACGGT
>probe:Drosophila_2:1634649_at:37:709; Interrogation_Position=3640; Antisense; TTCAAAATGCAAGAGTGCCCCGGGT
>probe:Drosophila_2:1634649_at:391:183; Interrogation_Position=3643; Antisense; AAAATGCAAGAGTGCCCCGGGTACG
>probe:Drosophila_2:1634649_at:177:667; Interrogation_Position=3718; Antisense; TATGGAAAACGAAAGCGTGGCAACA
>probe:Drosophila_2:1634649_at:653:513; Interrogation_Position=3765; Antisense; GTGTTTTATTTAACTGAATTTCGAT
>probe:Drosophila_2:1634649_at:721:191; Interrogation_Position=3776; Antisense; AACTGAATTTCGATCATTAATAGTA
>probe:Drosophila_2:1634649_at:1:17; Interrogation_Position=3826; Antisense; ATTTTTTGCCATTTGTACTGATTAC
>probe:Drosophila_2:1634649_at:585:313; Interrogation_Position=3833; Antisense; GCCATTTGTACTGATTACTGATTAA
>probe:Drosophila_2:1634649_at:539:657; Interrogation_Position=3963; Antisense; TAAGGTGGAAACACTGTGGCAATAT
>probe:Drosophila_2:1634649_at:45:391; Interrogation_Position=3970; Antisense; GAAACACTGTGGCAATATGAAAAAG
>probe:Drosophila_2:1634649_at:639:557; Interrogation_Position=3999; Antisense; GGAAATTAAATTGTTTGACGCTAAT

Paste this into a BLAST search page for me
ACTGCAATATAGCTGTATGTATTCAGTCAGAATTGGGATACTTAACTAATATACTTAACTAATCTGCTACCCTCCTAATCTGCTACCCTCCCAAAACGGTTTCAAAATGCAAGAGTGCCCCGGGTAAAATGCAAGAGTGCCCCGGGTACGTATGGAAAACGAAAGCGTGGCAACAGTGTTTTATTTAACTGAATTTCGATAACTGAATTTCGATCATTAATAGTAATTTTTTGCCATTTGTACTGATTACGCCATTTGTACTGATTACTGATTAATAAGGTGGAAACACTGTGGCAATATGAAACACTGTGGCAATATGAAAAAGGGAAATTAAATTGTTTGACGCTAAT

Full Affymetrix probeset data:

Annotations for 1634649_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720