FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634650_at:

>probe:Drosophila_2:1634650_at:61:311; Interrogation_Position=1263; Antisense; CCAAATTCGTTGGTCGATGGTCGAT
>probe:Drosophila_2:1634650_at:19:461; Interrogation_Position=1312; Antisense; GATTACTTCCCCACTCGTTTTATAT
>probe:Drosophila_2:1634650_at:336:525; Interrogation_Position=1350; Antisense; GGGCAGGACATATGGCCACATCCAG
>probe:Drosophila_2:1634650_at:1:581; Interrogation_Position=1363; Antisense; GGCCACATCCAGTAATTGCATTCCA
>probe:Drosophila_2:1634650_at:184:709; Interrogation_Position=1378; Antisense; TTGCATTCCACTTAAACCCACGTTT
>probe:Drosophila_2:1634650_at:177:695; Interrogation_Position=1402; Antisense; TTTCGAAAGCAAGCAGCGGCGCTAT
>probe:Drosophila_2:1634650_at:340:373; Interrogation_Position=1479; Antisense; GAAGAGCGTTCGGAGTTTGACACAA
>probe:Drosophila_2:1634650_at:643:479; Interrogation_Position=1493; Antisense; GTTTGACACAAACTTTCGCCCTGGT
>probe:Drosophila_2:1634650_at:306:313; Interrogation_Position=1516; Antisense; GTCGGTCTTTTTGTTTAGCCATTGT
>probe:Drosophila_2:1634650_at:97:435; Interrogation_Position=1560; Antisense; GAGGTGTATGTCAATCGGCAGTTTA
>probe:Drosophila_2:1634650_at:480:705; Interrogation_Position=1606; Antisense; TTAGCCCTGAGGTGGTGGACACTGT
>probe:Drosophila_2:1634650_at:101:51; Interrogation_Position=1701; Antisense; ATGCGAGTCTATCAGAATCCGTGGT
>probe:Drosophila_2:1634650_at:74:235; Interrogation_Position=1716; Antisense; AATCCGTGGTTCTTTAGTGAGTAGT
>probe:Drosophila_2:1634650_at:291:457; Interrogation_Position=1789; Antisense; GATACGCTCGTGTTTCATTATACAA

Paste this into a BLAST search page for me
CCAAATTCGTTGGTCGATGGTCGATGATTACTTCCCCACTCGTTTTATATGGGCAGGACATATGGCCACATCCAGGGCCACATCCAGTAATTGCATTCCATTGCATTCCACTTAAACCCACGTTTTTTCGAAAGCAAGCAGCGGCGCTATGAAGAGCGTTCGGAGTTTGACACAAGTTTGACACAAACTTTCGCCCTGGTGTCGGTCTTTTTGTTTAGCCATTGTGAGGTGTATGTCAATCGGCAGTTTATTAGCCCTGAGGTGGTGGACACTGTATGCGAGTCTATCAGAATCCGTGGTAATCCGTGGTTCTTTAGTGAGTAGTGATACGCTCGTGTTTCATTATACAA

Full Affymetrix probeset data:

Annotations for 1634650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720