FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634651_at:

>probe:Drosophila_2:1634651_at:728:33; Interrogation_Position=101; Antisense; ATCTTAATAAGCTGGCGGAGTGCAC
>probe:Drosophila_2:1634651_at:611:289; Interrogation_Position=116; Antisense; CGGAGTGCACAGAATCGGGATTGAA
>probe:Drosophila_2:1634651_at:363:393; Interrogation_Position=138; Antisense; GAAAGTAGCCACAACGTTGCTCGTG
>probe:Drosophila_2:1634651_at:45:139; Interrogation_Position=151; Antisense; ACGTTGCTCGTGAGGGCGATACCAT
>probe:Drosophila_2:1634651_at:408:167; Interrogation_Position=193; Antisense; AAATGTGCTGACTTTCGAGCCATTA
>probe:Drosophila_2:1634651_at:577:73; Interrogation_Position=224; Antisense; AGGACCTTGATATTACCGCACTTGC
>probe:Drosophila_2:1634651_at:648:185; Interrogation_Position=23; Antisense; AACAAGTCTTTTACATCGCCTTCAG
>probe:Drosophila_2:1634651_at:692:149; Interrogation_Position=243; Antisense; ACTTGCCCTCTTGGGCTATCAATAT
>probe:Drosophila_2:1634651_at:698:277; Interrogation_Position=258; Antisense; CTATCAATATCTGCAAACGGTCGTG
>probe:Drosophila_2:1634651_at:243:211; Interrogation_Position=314; Antisense; AAGAAGGCTACGACGCTGTGTCGCC
>probe:Drosophila_2:1634651_at:100:503; Interrogation_Position=333; Antisense; GTCGCCACACCTTGACAAACTTATT
>probe:Drosophila_2:1634651_at:602:81; Interrogation_Position=358; Antisense; AGTGGCAAGTGCCTACCAGGGCTCA
>probe:Drosophila_2:1634651_at:177:117; Interrogation_Position=46; Antisense; AGCTTGCTTCTGCTGGGATCCTTGC
>probe:Drosophila_2:1634651_at:85:529; Interrogation_Position=60; Antisense; GGGATCCTTGCTGCCAAACGAAGTG

Paste this into a BLAST search page for me
ATCTTAATAAGCTGGCGGAGTGCACCGGAGTGCACAGAATCGGGATTGAAGAAAGTAGCCACAACGTTGCTCGTGACGTTGCTCGTGAGGGCGATACCATAAATGTGCTGACTTTCGAGCCATTAAGGACCTTGATATTACCGCACTTGCAACAAGTCTTTTACATCGCCTTCAGACTTGCCCTCTTGGGCTATCAATATCTATCAATATCTGCAAACGGTCGTGAAGAAGGCTACGACGCTGTGTCGCCGTCGCCACACCTTGACAAACTTATTAGTGGCAAGTGCCTACCAGGGCTCAAGCTTGCTTCTGCTGGGATCCTTGCGGGATCCTTGCTGCCAAACGAAGTG

Full Affymetrix probeset data:

Annotations for 1634651_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720