Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634654_at:

>probe:Drosophila_2:1634654_at:195:319; Interrogation_Position=15644; Antisense; GCCGTGCTGTGCAAAGCCTTGTTGG
>probe:Drosophila_2:1634654_at:640:103; Interrogation_Position=15676; Antisense; AGACCGCCAGGTCAAGGATTACACT
>probe:Drosophila_2:1634654_at:723:707; Interrogation_Position=15703; Antisense; TTACAAGCCCTTCCTTATGATGTGG
>probe:Drosophila_2:1634654_at:526:343; Interrogation_Position=15728; Antisense; GCATTGGTGGACTTGATCTACGACA
>probe:Drosophila_2:1634654_at:714:473; Interrogation_Position=15757; Antisense; GTTCAAGACGGTAAGCACGCCCAAG
>probe:Drosophila_2:1634654_at:94:549; Interrogation_Position=15784; Antisense; GGAGGATTGGCCGATTTCCCTGTTC
>probe:Drosophila_2:1634654_at:535:719; Interrogation_Position=15799; Antisense; TTCCCTGTTCGACTATCTTCGTAAG
>probe:Drosophila_2:1634654_at:330:439; Interrogation_Position=15830; Antisense; GAGGCTTTGCTCAAGTCCACGGATA
>probe:Drosophila_2:1634654_at:612:23; Interrogation_Position=15852; Antisense; ATAGCATCCTGCAGACCCTAACGGA
>probe:Drosophila_2:1634654_at:287:653; Interrogation_Position=15870; Antisense; TAACGGAGGAGTTCCTGCCCTGCAC
>probe:Drosophila_2:1634654_at:669:355; Interrogation_Position=15891; Antisense; GCACTTCCTTTGTCGAATTCTGTGA
>probe:Drosophila_2:1634654_at:138:247; Interrogation_Position=15906; Antisense; AATTCTGTGATGTTGCAGGTCTCCT
>probe:Drosophila_2:1634654_at:349:161; Interrogation_Position=16006; Antisense; AAATGCAATCGCTGTTTCTAACCAA
>probe:Drosophila_2:1634654_at:229:385; Interrogation_Position=16041; Antisense; GAACTTTAAGCGATTGCTGCGTATA

Paste this into a BLAST search page for me
GCCGTGCTGTGCAAAGCCTTGTTGGAGACCGCCAGGTCAAGGATTACACTTTACAAGCCCTTCCTTATGATGTGGGCATTGGTGGACTTGATCTACGACAGTTCAAGACGGTAAGCACGCCCAAGGGAGGATTGGCCGATTTCCCTGTTCTTCCCTGTTCGACTATCTTCGTAAGGAGGCTTTGCTCAAGTCCACGGATAATAGCATCCTGCAGACCCTAACGGATAACGGAGGAGTTCCTGCCCTGCACGCACTTCCTTTGTCGAATTCTGTGAAATTCTGTGATGTTGCAGGTCTCCTAAATGCAATCGCTGTTTCTAACCAAGAACTTTAAGCGATTGCTGCGTATA

Full Affymetrix probeset data:

Annotations for 1634654_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime