FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634655_at:

>probe:Drosophila_2:1634655_at:567:417; Interrogation_Position=1031; Antisense; GAGCTGCCACTACCGGAGAGCATCA
>probe:Drosophila_2:1634655_at:584:419; Interrogation_Position=1048; Antisense; GAGCATCAAGCGATTTCTGCTGCGC
>probe:Drosophila_2:1634655_at:174:679; Interrogation_Position=1079; Antisense; TAGGGCTCTGGACCATGAGCTCTAT
>probe:Drosophila_2:1634655_at:41:501; Interrogation_Position=1166; Antisense; GTCGTGATAGTCTGTTTACCCATAT
>probe:Drosophila_2:1634655_at:523:687; Interrogation_Position=1190; Antisense; TATATATTGTATACGCCTGCAGCGC
>probe:Drosophila_2:1634655_at:57:617; Interrogation_Position=1207; Antisense; TGCAGCGCTAGTGAAGGGCCCTTTC
>probe:Drosophila_2:1634655_at:651:451; Interrogation_Position=1276; Antisense; GATCTCCGCTAGAGGGCGCTTATAT
>probe:Drosophila_2:1634655_at:28:29; Interrogation_Position=1346; Antisense; ATACACTCTTTACCTGGACGACCTA
>probe:Drosophila_2:1634655_at:3:467; Interrogation_Position=1372; Antisense; GTTGTAGATCATAATCCTCGCCATC
>probe:Drosophila_2:1634655_at:31:49; Interrogation_Position=1385; Antisense; ATCCTCGCCATCGTTTGTGTATGTG
>probe:Drosophila_2:1634655_at:685:517; Interrogation_Position=1407; Antisense; GTGTGGATCACCAACACCAGCGGAG
>probe:Drosophila_2:1634655_at:381:133; Interrogation_Position=1491; Antisense; ACCGCCTAAGCGTATTGTTGCTATA
>probe:Drosophila_2:1634655_at:122:619; Interrogation_Position=975; Antisense; TGCAGAGCGCTTGTCGCAACGTTAT
>probe:Drosophila_2:1634655_at:413:599; Interrogation_Position=986; Antisense; TGTCGCAACGTTATCCTGGAGAGCT

Paste this into a BLAST search page for me
GAGCTGCCACTACCGGAGAGCATCAGAGCATCAAGCGATTTCTGCTGCGCTAGGGCTCTGGACCATGAGCTCTATGTCGTGATAGTCTGTTTACCCATATTATATATTGTATACGCCTGCAGCGCTGCAGCGCTAGTGAAGGGCCCTTTCGATCTCCGCTAGAGGGCGCTTATATATACACTCTTTACCTGGACGACCTAGTTGTAGATCATAATCCTCGCCATCATCCTCGCCATCGTTTGTGTATGTGGTGTGGATCACCAACACCAGCGGAGACCGCCTAAGCGTATTGTTGCTATATGCAGAGCGCTTGTCGCAACGTTATTGTCGCAACGTTATCCTGGAGAGCT

Full Affymetrix probeset data:

Annotations for 1634655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720