Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634656_s_at:

>probe:Drosophila_2:1634656_s_at:345:171; Interrogation_Position=288; Antisense; AAAGTGGCAGCTACGAATCCCAAGT
>probe:Drosophila_2:1634656_s_at:45:237; Interrogation_Position=303; Antisense; AATCCCAAGTGCGTGGTCAAGCCAG
>probe:Drosophila_2:1634656_s_at:668:125; Interrogation_Position=322; Antisense; AGCCAGAAATCGTCTGCGATCGCCA
>probe:Drosophila_2:1634656_s_at:570:479; Interrogation_Position=362; Antisense; GTTTGCCCTGATTGATTCAGCGCAA
>probe:Drosophila_2:1634656_s_at:696:89; Interrogation_Position=398; Antisense; AGTCAAGGAGATCCGCTTCAACAGC
>probe:Drosophila_2:1634656_s_at:36:279; Interrogation_Position=429; Antisense; CTAAACACACTAGAGCTGCTGCAGC
>probe:Drosophila_2:1634656_s_at:431:597; Interrogation_Position=454; Antisense; TGTGCAACAAGCACGTGTCCAGCTT
>probe:Drosophila_2:1634656_s_at:394:729; Interrogation_Position=477; Antisense; TTGGCACCGCGCGAGGAGATCACCA
>probe:Drosophila_2:1634656_s_at:651:95; Interrogation_Position=493; Antisense; AGATCACCAACAAGGTCCTGACCAA
>probe:Drosophila_2:1634656_s_at:609:37; Interrogation_Position=632; Antisense; ATCTACCAGGATATACCCGCATTCT
>probe:Drosophila_2:1634656_s_at:343:37; Interrogation_Position=662; Antisense; ATCTTCACCGAGGAGAGCTTCTACA
>probe:Drosophila_2:1634656_s_at:572:667; Interrogation_Position=683; Antisense; TACATGTTCGCCTTCTGTTTCGTGT
>probe:Drosophila_2:1634656_s_at:213:203; Interrogation_Position=755; Antisense; AAGCCCGTCGATTTCTAAGCCAATT
>probe:Drosophila_2:1634656_s_at:282:481; Interrogation_Position=780; Antisense; GTATTGTTCAATTCCGCACACGTAC

Paste this into a BLAST search page for me
AAAGTGGCAGCTACGAATCCCAAGTAATCCCAAGTGCGTGGTCAAGCCAGAGCCAGAAATCGTCTGCGATCGCCAGTTTGCCCTGATTGATTCAGCGCAAAGTCAAGGAGATCCGCTTCAACAGCCTAAACACACTAGAGCTGCTGCAGCTGTGCAACAAGCACGTGTCCAGCTTTTGGCACCGCGCGAGGAGATCACCAAGATCACCAACAAGGTCCTGACCAAATCTACCAGGATATACCCGCATTCTATCTTCACCGAGGAGAGCTTCTACATACATGTTCGCCTTCTGTTTCGTGTAAGCCCGTCGATTTCTAAGCCAATTGTATTGTTCAATTCCGCACACGTAC

Full Affymetrix probeset data:

Annotations for 1634656_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime