FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634657_at:

>probe:Drosophila_2:1634657_at:224:29; Interrogation_Position=508; Antisense; ATAAAAGAAAGTCCCTCTCCACTAG
>probe:Drosophila_2:1634657_at:273:503; Interrogation_Position=518; Antisense; GTCCCTCTCCACTAGAATGCAGATA
>probe:Drosophila_2:1634657_at:428:369; Interrogation_Position=532; Antisense; GAATGCAGATAAGATTACAGCCTAC
>probe:Drosophila_2:1634657_at:475:665; Interrogation_Position=547; Antisense; TACAGCCTACTGAAACTATGTTACT
>probe:Drosophila_2:1634657_at:477:267; Interrogation_Position=590; Antisense; CAGGAGTGAGCCAGTTTAGTGTACA
>probe:Drosophila_2:1634657_at:582:677; Interrogation_Position=606; Antisense; TAGTGTACAACAGAAGCCCGCCAAG
>probe:Drosophila_2:1634657_at:61:109; Interrogation_Position=617; Antisense; AGAAGCCCGCCAAGCAAAGATGCCT
>probe:Drosophila_2:1634657_at:347:157; Interrogation_Position=745; Antisense; ACACGCCAGTGCATCCGATTTACCA
>probe:Drosophila_2:1634657_at:266:461; Interrogation_Position=761; Antisense; GATTTACCACGAACCTCCTCACGGA
>probe:Drosophila_2:1634657_at:150:349; Interrogation_Position=815; Antisense; GCATGGTCCGTATCCATATGGTCCA
>probe:Drosophila_2:1634657_at:264:13; Interrogation_Position=830; Antisense; ATATGGTCCAGGATACGTGGCCCCA
>probe:Drosophila_2:1634657_at:420:75; Interrogation_Position=854; Antisense; AGGACCTCCAATGCATCCGCGATAA
>probe:Drosophila_2:1634657_at:321:347; Interrogation_Position=866; Antisense; GCATCCGCGATAAGAACTGAACTGT
>probe:Drosophila_2:1634657_at:423:383; Interrogation_Position=879; Antisense; GAACTGAACTGTAATCTAGATCGGT

Paste this into a BLAST search page for me
ATAAAAGAAAGTCCCTCTCCACTAGGTCCCTCTCCACTAGAATGCAGATAGAATGCAGATAAGATTACAGCCTACTACAGCCTACTGAAACTATGTTACTCAGGAGTGAGCCAGTTTAGTGTACATAGTGTACAACAGAAGCCCGCCAAGAGAAGCCCGCCAAGCAAAGATGCCTACACGCCAGTGCATCCGATTTACCAGATTTACCACGAACCTCCTCACGGAGCATGGTCCGTATCCATATGGTCCAATATGGTCCAGGATACGTGGCCCCAAGGACCTCCAATGCATCCGCGATAAGCATCCGCGATAAGAACTGAACTGTGAACTGAACTGTAATCTAGATCGGT

Full Affymetrix probeset data:

Annotations for 1634657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720