FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634659_at:

>probe:Drosophila_2:1634659_at:567:451; Interrogation_Position=4699; Antisense; GATCTCAAAACCGAAGACAACCAGA
>probe:Drosophila_2:1634659_at:346:397; Interrogation_Position=4714; Antisense; GACAACCAGACCTTGTGCAGCACGA
>probe:Drosophila_2:1634659_at:607:615; Interrogation_Position=4729; Antisense; TGCAGCACGAAGACGCAAAAACTGT
>probe:Drosophila_2:1634659_at:5:347; Interrogation_Position=4805; Antisense; GCAAATGGTTCCTCGTTAGTGTAAA
>probe:Drosophila_2:1634659_at:327:507; Interrogation_Position=4852; Antisense; GTGCTAGAAACAAACTGTGCAGCTA
>probe:Drosophila_2:1634659_at:460:195; Interrogation_Position=4864; Antisense; AACTGTGCAGCTAATTATCTGATAA
>probe:Drosophila_2:1634659_at:223:41; Interrogation_Position=4880; Antisense; ATCTGATAAATCCTACGCAGTATAT
>probe:Drosophila_2:1634659_at:50:701; Interrogation_Position=4908; Antisense; TTTATATGTTTGCTCCACAGCTCTC
>probe:Drosophila_2:1634659_at:466:263; Interrogation_Position=4925; Antisense; CAGCTCTCTCATCCAATTTTGTACA
>probe:Drosophila_2:1634659_at:725:91; Interrogation_Position=4953; Antisense; AGTTCTCCGATATAAGCTTTTACAG
>probe:Drosophila_2:1634659_at:147:117; Interrogation_Position=4967; Antisense; AGCTTTTACAGCCTATAGCCACACA
>probe:Drosophila_2:1634659_at:695:315; Interrogation_Position=4977; Antisense; GCCTATAGCCACACACACATATATT
>probe:Drosophila_2:1634659_at:353:215; Interrogation_Position=5121; Antisense; AAGTTGATACGACCTTAGAAAGCAA
>probe:Drosophila_2:1634659_at:656:83; Interrogation_Position=5218; Antisense; AGTGTTGTACTTACGATTTAGTCTA

Paste this into a BLAST search page for me
GATCTCAAAACCGAAGACAACCAGAGACAACCAGACCTTGTGCAGCACGATGCAGCACGAAGACGCAAAAACTGTGCAAATGGTTCCTCGTTAGTGTAAAGTGCTAGAAACAAACTGTGCAGCTAAACTGTGCAGCTAATTATCTGATAAATCTGATAAATCCTACGCAGTATATTTTATATGTTTGCTCCACAGCTCTCCAGCTCTCTCATCCAATTTTGTACAAGTTCTCCGATATAAGCTTTTACAGAGCTTTTACAGCCTATAGCCACACAGCCTATAGCCACACACACATATATTAAGTTGATACGACCTTAGAAAGCAAAGTGTTGTACTTACGATTTAGTCTA

Full Affymetrix probeset data:

Annotations for 1634659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720