FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634660_at:

>probe:Drosophila_2:1634660_at:41:391; Interrogation_Position=2229; Antisense; GAAACCGAGCTTCAGACTCCGGAAA
>probe:Drosophila_2:1634660_at:152:411; Interrogation_Position=2373; Antisense; GACGAAGGCGACTACGACGAGAACA
>probe:Drosophila_2:1634660_at:431:107; Interrogation_Position=2392; Antisense; AGAACATGGCCAATGACAGCGACCT
>probe:Drosophila_2:1634660_at:355:167; Interrogation_Position=2419; Antisense; AAATGTCCAATCTAGCCATGTCCGA
>probe:Drosophila_2:1634660_at:686:571; Interrogation_Position=2445; Antisense; GGCTCCAACAATGCCGAAATCATTA
>probe:Drosophila_2:1634660_at:141:435; Interrogation_Position=2473; Antisense; GAGGGCACTAGATGGCTATCTCCTA
>probe:Drosophila_2:1634660_at:700:99; Interrogation_Position=2482; Antisense; AGATGGCTATCTCCTAACTTCCTAA
>probe:Drosophila_2:1634660_at:101:275; Interrogation_Position=2499; Antisense; CTTCCTAACACATCGCCAAGTATTA
>probe:Drosophila_2:1634660_at:108:189; Interrogation_Position=2537; Antisense; AACACCATTGTTAATACCGATTCAT
>probe:Drosophila_2:1634660_at:288:9; Interrogation_Position=2560; Antisense; ATTCCAATCGCATTCCTTAAGCTAT
>probe:Drosophila_2:1634660_at:598:687; Interrogation_Position=2609; Antisense; TATATATTCCTAGAGCCAGACCCGC
>probe:Drosophila_2:1634660_at:170:313; Interrogation_Position=2623; Antisense; GCCAGACCCGCGCATTGTTAAAAGA
>probe:Drosophila_2:1634660_at:375:689; Interrogation_Position=2706; Antisense; TATTGTTCATCAACCGTCTATGCCC
>probe:Drosophila_2:1634660_at:601:497; Interrogation_Position=2721; Antisense; GTCTATGCCCCAAAGTGCTGTAAAG

Paste this into a BLAST search page for me
GAAACCGAGCTTCAGACTCCGGAAAGACGAAGGCGACTACGACGAGAACAAGAACATGGCCAATGACAGCGACCTAAATGTCCAATCTAGCCATGTCCGAGGCTCCAACAATGCCGAAATCATTAGAGGGCACTAGATGGCTATCTCCTAAGATGGCTATCTCCTAACTTCCTAACTTCCTAACACATCGCCAAGTATTAAACACCATTGTTAATACCGATTCATATTCCAATCGCATTCCTTAAGCTATTATATATTCCTAGAGCCAGACCCGCGCCAGACCCGCGCATTGTTAAAAGATATTGTTCATCAACCGTCTATGCCCGTCTATGCCCCAAAGTGCTGTAAAG

Full Affymetrix probeset data:

Annotations for 1634660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720