FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634661_at:

>probe:Drosophila_2:1634661_at:636:155; Interrogation_Position=748; Antisense; ACACCTGTCTGGGACGTAAGTATCA
>probe:Drosophila_2:1634661_at:460:589; Interrogation_Position=757; Antisense; TGGGACGTAAGTATCAGCCGACCGC
>probe:Drosophila_2:1634661_at:550:407; Interrogation_Position=760; Antisense; GACGTAAGTATCAGCCGACCGCCGG
>probe:Drosophila_2:1634661_at:528:317; Interrogation_Position=780; Antisense; GCCGGCCAGCTATTGTGGCCCTAAT
>probe:Drosophila_2:1634661_at:345:691; Interrogation_Position=790; Antisense; TATTGTGGCCCTAATTCTCACCAGA
>probe:Drosophila_2:1634661_at:124:653; Interrogation_Position=801; Antisense; TAATTCTCACCAGATTGCCCGGGAC
>probe:Drosophila_2:1634661_at:186:93; Interrogation_Position=812; Antisense; AGATTGCCCGGGACTACTTACTCAT
>probe:Drosophila_2:1634661_at:278:303; Interrogation_Position=819; Antisense; CCGGGACTACTTACTCATATACTAC
>probe:Drosophila_2:1634661_at:621:403; Interrogation_Position=823; Antisense; GACTACTTACTCATATACTACAGAT
>probe:Drosophila_2:1634661_at:250:249; Interrogation_Position=852; Antisense; CAATTAACTGTTTGGCATGCGGTCT
>probe:Drosophila_2:1634661_at:312:661; Interrogation_Position=856; Antisense; TAACTGTTTGGCATGCGGTCTTTTG
>probe:Drosophila_2:1634661_at:206:691; Interrogation_Position=862; Antisense; TTTGGCATGCGGTCTTTTGGTGTAT
>probe:Drosophila_2:1634661_at:662:481; Interrogation_Position=883; Antisense; GTATTGCAATAAACGGACAGCCGGG
>probe:Drosophila_2:1634661_at:58:397; Interrogation_Position=898; Antisense; GACAGCCGGGCAGCCGACTAATAAT

Paste this into a BLAST search page for me
ACACCTGTCTGGGACGTAAGTATCATGGGACGTAAGTATCAGCCGACCGCGACGTAAGTATCAGCCGACCGCCGGGCCGGCCAGCTATTGTGGCCCTAATTATTGTGGCCCTAATTCTCACCAGATAATTCTCACCAGATTGCCCGGGACAGATTGCCCGGGACTACTTACTCATCCGGGACTACTTACTCATATACTACGACTACTTACTCATATACTACAGATCAATTAACTGTTTGGCATGCGGTCTTAACTGTTTGGCATGCGGTCTTTTGTTTGGCATGCGGTCTTTTGGTGTATGTATTGCAATAAACGGACAGCCGGGGACAGCCGGGCAGCCGACTAATAAT

Full Affymetrix probeset data:

Annotations for 1634661_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720