FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634662_at:

>probe:Drosophila_2:1634662_at:196:169; Interrogation_Position=1025; Antisense; AAATGGTGTCTTCCCAGATGCCGGA
>probe:Drosophila_2:1634662_at:264:195; Interrogation_Position=1081; Antisense; AACTGGACTACTTGGAGCGCGTGAT
>probe:Drosophila_2:1634662_at:312:225; Interrogation_Position=1107; Antisense; AAGGAGACACTACGCCTGATACCTG
>probe:Drosophila_2:1634662_at:531:317; Interrogation_Position=1120; Antisense; GCCTGATACCTGCTATTCCAATAAC
>probe:Drosophila_2:1634662_at:159:257; Interrogation_Position=1156; Antisense; CAAAGAATGATGTTCGTCTCTCGAA
>probe:Drosophila_2:1634662_at:675:227; Interrogation_Position=1179; Antisense; AATGGAGTTCTCATTCCCAAAGGAG
>probe:Drosophila_2:1634662_at:730:717; Interrogation_Position=1192; Antisense; TTCCCAAAGGAGTCGTCATCGGCAT
>probe:Drosophila_2:1634662_at:369:41; Interrogation_Position=1209; Antisense; ATCGGCATCGACATGTTTCACACTC
>probe:Drosophila_2:1634662_at:702:527; Interrogation_Position=1253; Antisense; GGGACCAGATGCAGACAACTTTAAT
>probe:Drosophila_2:1634662_at:68:273; Interrogation_Position=1318; Antisense; CATATGCCTACATTCCATTTGCGAG
>probe:Drosophila_2:1634662_at:270:113; Interrogation_Position=1434; Antisense; AGCACTCTCTACAAGGATCTGGTTT
>probe:Drosophila_2:1634662_at:228:391; Interrogation_Position=1478; Antisense; GAAACTGGCTGAGTATCCTCGACTT
>probe:Drosophila_2:1634662_at:669:317; Interrogation_Position=933; Antisense; GCCGGCTATGATACATCAGCTCTAA
>probe:Drosophila_2:1634662_at:230:337; Interrogation_Position=951; Antisense; GCTCTAACAGTTTATCACGCACTCT

Paste this into a BLAST search page for me
AAATGGTGTCTTCCCAGATGCCGGAAACTGGACTACTTGGAGCGCGTGATAAGGAGACACTACGCCTGATACCTGGCCTGATACCTGCTATTCCAATAACCAAAGAATGATGTTCGTCTCTCGAAAATGGAGTTCTCATTCCCAAAGGAGTTCCCAAAGGAGTCGTCATCGGCATATCGGCATCGACATGTTTCACACTCGGGACCAGATGCAGACAACTTTAATCATATGCCTACATTCCATTTGCGAGAGCACTCTCTACAAGGATCTGGTTTGAAACTGGCTGAGTATCCTCGACTTGCCGGCTATGATACATCAGCTCTAAGCTCTAACAGTTTATCACGCACTCT

Full Affymetrix probeset data:

Annotations for 1634662_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720