Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634663_at:

>probe:Drosophila_2:1634663_at:714:143; Interrogation_Position=1071; Antisense; ACTGCCTGCAGCGTGTGATTGCCAT
>probe:Drosophila_2:1634663_at:591:721; Interrogation_Position=1089; Antisense; TTGCCATGCGAGCAATACGCTTTTT
>probe:Drosophila_2:1634663_at:256:605; Interrogation_Position=1179; Antisense; TGATCAAGATCGACTGCCCGGATGA
>probe:Drosophila_2:1634663_at:227:405; Interrogation_Position=1190; Antisense; GACTGCCCGGATGACAGCATTTTGA
>probe:Drosophila_2:1634663_at:66:641; Interrogation_Position=1322; Antisense; TCTGATCTGATGTCCACCTATGTGG
>probe:Drosophila_2:1634663_at:688:277; Interrogation_Position=1339; Antisense; CTATGTGGATGAGTTCGCTGGCTTC
>probe:Drosophila_2:1634663_at:691:331; Interrogation_Position=1355; Antisense; GCTGGCTTCGGCGATTAACTCGATG
>probe:Drosophila_2:1634663_at:140:419; Interrogation_Position=1386; Antisense; GAGCTCCCACCTTACATTTAGTATA
>probe:Drosophila_2:1634663_at:492:211; Interrogation_Position=1414; Antisense; AAGACTGTGACTGCGTTTGTGATAC
>probe:Drosophila_2:1634663_at:458:617; Interrogation_Position=1482; Antisense; TGCACCGCGGCATACATGAAGTACA
>probe:Drosophila_2:1634663_at:360:673; Interrogation_Position=1518; Antisense; TACCCACAAACATCATCTAGCATAC
>probe:Drosophila_2:1634663_at:584:437; Interrogation_Position=1548; Antisense; GAGGAAGGCCACTGACGACGTGTTC
>probe:Drosophila_2:1634663_at:646:409; Interrogation_Position=1561; Antisense; GACGACGTGTTCACCCAAGACTAAA
>probe:Drosophila_2:1634663_at:456:95; Interrogation_Position=1608; Antisense; AGATTTGACTGCCATTTGCTACGTA

Paste this into a BLAST search page for me
ACTGCCTGCAGCGTGTGATTGCCATTTGCCATGCGAGCAATACGCTTTTTTGATCAAGATCGACTGCCCGGATGAGACTGCCCGGATGACAGCATTTTGATCTGATCTGATGTCCACCTATGTGGCTATGTGGATGAGTTCGCTGGCTTCGCTGGCTTCGGCGATTAACTCGATGGAGCTCCCACCTTACATTTAGTATAAAGACTGTGACTGCGTTTGTGATACTGCACCGCGGCATACATGAAGTACATACCCACAAACATCATCTAGCATACGAGGAAGGCCACTGACGACGTGTTCGACGACGTGTTCACCCAAGACTAAAAGATTTGACTGCCATTTGCTACGTA

Full Affymetrix probeset data:

Annotations for 1634663_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime