Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634664_at:

>probe:Drosophila_2:1634664_at:481:157; Interrogation_Position=1275; Antisense; ACAAAAGTTTGCACATTGCCCACCG
>probe:Drosophila_2:1634664_at:463:131; Interrogation_Position=1296; Antisense; ACCGTCATTAGGCTGAGCGAGTCCA
>probe:Drosophila_2:1634664_at:101:409; Interrogation_Position=1346; Antisense; GACGATCATGATACCCAACTACCAG
>probe:Drosophila_2:1634664_at:91:193; Interrogation_Position=1362; Antisense; AACTACCAGTTCCATCACGATAAGC
>probe:Drosophila_2:1634664_at:460:455; Interrogation_Position=1380; Antisense; GATAAGCAATACTTTCCCGAACCGG
>probe:Drosophila_2:1634664_at:99:549; Interrogation_Position=1403; Antisense; GGAGGCCTTCAAGCCAGAGCGATTT
>probe:Drosophila_2:1634664_at:675:225; Interrogation_Position=1459; Antisense; AAGGCATCTTTCTGCCGTTTAGCGA
>probe:Drosophila_2:1634664_at:713:697; Interrogation_Position=1476; Antisense; TTTAGCGATGGTCCCCGTATCTGCA
>probe:Drosophila_2:1634664_at:12:41; Interrogation_Position=1494; Antisense; ATCTGCATGGGTGTTCCATTGGCCA
>probe:Drosophila_2:1634664_at:614:51; Interrogation_Position=1518; Antisense; ATGCTGACTCTGAAATCGGCTCTGG
>probe:Drosophila_2:1634664_at:578:591; Interrogation_Position=1540; Antisense; TGGTCCACATCCTTAGCAACTTTCA
>probe:Drosophila_2:1634664_at:625:473; Interrogation_Position=1635; Antisense; GTTAATCTCGAATATCGCCGCTTTT
>probe:Drosophila_2:1634664_at:173:633; Interrogation_Position=1649; Antisense; TCGCCGCTTTTTCAGATAGACTTGT
>probe:Drosophila_2:1634664_at:570:147; Interrogation_Position=1787; Antisense; ACTTACCTCTCCAACAAAATCTTAT

Paste this into a BLAST search page for me
ACAAAAGTTTGCACATTGCCCACCGACCGTCATTAGGCTGAGCGAGTCCAGACGATCATGATACCCAACTACCAGAACTACCAGTTCCATCACGATAAGCGATAAGCAATACTTTCCCGAACCGGGGAGGCCTTCAAGCCAGAGCGATTTAAGGCATCTTTCTGCCGTTTAGCGATTTAGCGATGGTCCCCGTATCTGCAATCTGCATGGGTGTTCCATTGGCCAATGCTGACTCTGAAATCGGCTCTGGTGGTCCACATCCTTAGCAACTTTCAGTTAATCTCGAATATCGCCGCTTTTTCGCCGCTTTTTCAGATAGACTTGTACTTACCTCTCCAACAAAATCTTAT

Full Affymetrix probeset data:

Annotations for 1634664_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime