FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634665_at:

>probe:Drosophila_2:1634665_at:496:315; Interrogation_Position=118; Antisense; GCCTTTACCATCGATTTTGCTGTGA
>probe:Drosophila_2:1634665_at:491:607; Interrogation_Position=186; Antisense; TGATGGCTGCCAATTCCTGATGAAT
>probe:Drosophila_2:1634665_at:642:445; Interrogation_Position=204; Antisense; GATGAATCCCCTGATGAATCGCGTT
>probe:Drosophila_2:1634665_at:655:305; Interrogation_Position=21; Antisense; CCTGGCGACCAGTTGTGATCACAAT
>probe:Drosophila_2:1634665_at:395:365; Interrogation_Position=219; Antisense; GAATCGCGTTTTCGGAACTGTATAC
>probe:Drosophila_2:1634665_at:484:383; Interrogation_Position=233; Antisense; GAACTGTATACAAACGGCTGGTCGT
>probe:Drosophila_2:1634665_at:586:573; Interrogation_Position=248; Antisense; GGCTGGTCGTGAATGGCAGTTTCTT
>probe:Drosophila_2:1634665_at:280:349; Interrogation_Position=263; Antisense; GCAGTTTCTTTAGTTGCCCAATTAA
>probe:Drosophila_2:1634665_at:133:199; Interrogation_Position=310; Antisense; AACGAGGGTTCCGTGGCCATGTTGC
>probe:Drosophila_2:1634665_at:136:629; Interrogation_Position=341; Antisense; TCCAGCCGCCTGGAAGATACCAAAT
>probe:Drosophila_2:1634665_at:478:457; Interrogation_Position=356; Antisense; GATACCAAATCACCATGCGCGTCAG
>probe:Drosophila_2:1634665_at:607:445; Interrogation_Position=381; Antisense; GATGCGAGAAAGTAGGGACCCCTTT
>probe:Drosophila_2:1634665_at:717:89; Interrogation_Position=53; Antisense; AGTATTTTCATAAAGCTCCCGACAT
>probe:Drosophila_2:1634665_at:141:337; Interrogation_Position=67; Antisense; GCTCCCGACATGGTGGATATTTACA

Paste this into a BLAST search page for me
GCCTTTACCATCGATTTTGCTGTGATGATGGCTGCCAATTCCTGATGAATGATGAATCCCCTGATGAATCGCGTTCCTGGCGACCAGTTGTGATCACAATGAATCGCGTTTTCGGAACTGTATACGAACTGTATACAAACGGCTGGTCGTGGCTGGTCGTGAATGGCAGTTTCTTGCAGTTTCTTTAGTTGCCCAATTAAAACGAGGGTTCCGTGGCCATGTTGCTCCAGCCGCCTGGAAGATACCAAATGATACCAAATCACCATGCGCGTCAGGATGCGAGAAAGTAGGGACCCCTTTAGTATTTTCATAAAGCTCCCGACATGCTCCCGACATGGTGGATATTTACA

Full Affymetrix probeset data:

Annotations for 1634665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720