Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634667_at:

>probe:Drosophila_2:1634667_at:344:225; Interrogation_Position=1777; Antisense; AAGGCATTTCGGCAGTCAACGCCAT
>probe:Drosophila_2:1634667_at:673:71; Interrogation_Position=1817; Antisense; AGGCATCCAAATATCTCACGTCCAG
>probe:Drosophila_2:1634667_at:473:257; Interrogation_Position=1833; Antisense; CACGTCCAGCGTTTGATGAGGTCTA
>probe:Drosophila_2:1634667_at:64:491; Interrogation_Position=1899; Antisense; GTCAACTTACCTTAACAACCTGTGG
>probe:Drosophila_2:1634667_at:579:727; Interrogation_Position=1929; Antisense; TTGGGCGTAGAGTCCACTATGCTCA
>probe:Drosophila_2:1634667_at:198:611; Interrogation_Position=1960; Antisense; TGACCATTCTCGCAGATCAGACGAT
>probe:Drosophila_2:1634667_at:467:447; Interrogation_Position=1982; Antisense; GATCCAGACAGGCACTACCATTTTG
>probe:Drosophila_2:1634667_at:707:195; Interrogation_Position=2011; Antisense; AACTGGTTCATATAGGCCTCGGCGA
>probe:Drosophila_2:1634667_at:462:109; Interrogation_Position=2047; Antisense; AGAAGTTGAGGCTCGTCCACCAAAA
>probe:Drosophila_2:1634667_at:417:347; Interrogation_Position=2095; Antisense; GCAGGTTGGGTCAATGGTCCCTTGA
>probe:Drosophila_2:1634667_at:218:261; Interrogation_Position=2132; Antisense; CATCCCAAAGTTTCCACCAGTAGAT
>probe:Drosophila_2:1634667_at:243:551; Interrogation_Position=2158; Antisense; GGAGTTTGCGGCTCATTGAACTGAT
>probe:Drosophila_2:1634667_at:616:305; Interrogation_Position=2214; Antisense; CCATGCCTTTTTCTCCATAAACGGA
>probe:Drosophila_2:1634667_at:66:555; Interrogation_Position=2236; Antisense; GGAGCCGGAAATGCACATCCCGAAA

Paste this into a BLAST search page for me
AAGGCATTTCGGCAGTCAACGCCATAGGCATCCAAATATCTCACGTCCAGCACGTCCAGCGTTTGATGAGGTCTAGTCAACTTACCTTAACAACCTGTGGTTGGGCGTAGAGTCCACTATGCTCATGACCATTCTCGCAGATCAGACGATGATCCAGACAGGCACTACCATTTTGAACTGGTTCATATAGGCCTCGGCGAAGAAGTTGAGGCTCGTCCACCAAAAGCAGGTTGGGTCAATGGTCCCTTGACATCCCAAAGTTTCCACCAGTAGATGGAGTTTGCGGCTCATTGAACTGATCCATGCCTTTTTCTCCATAAACGGAGGAGCCGGAAATGCACATCCCGAAA

Full Affymetrix probeset data:

Annotations for 1634667_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime