FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634668_at:

>probe:Drosophila_2:1634668_at:144:595; Interrogation_Position=1354; Antisense; TGGGCTATCGGCCTTGCAGCATATT
>probe:Drosophila_2:1634668_at:138:257; Interrogation_Position=1389; Antisense; CACTTTTTTAACCTGCCCAATTGCT
>probe:Drosophila_2:1634668_at:545:723; Interrogation_Position=1409; Antisense; TTGCTCGACGAGATTGGTGCCACTG
>probe:Drosophila_2:1634668_at:359:627; Interrogation_Position=1426; Antisense; TGCCACTGCCCGTTTTATTTTATTT
>probe:Drosophila_2:1634668_at:465:709; Interrogation_Position=1481; Antisense; TTAATGTCGCATTTACTCGTCTGTA
>probe:Drosophila_2:1634668_at:667:25; Interrogation_Position=1652; Antisense; ATAGAACAACTTGCGCCTCTTTGAT
>probe:Drosophila_2:1634668_at:117:13; Interrogation_Position=1675; Antisense; ATTCTCGATCAGGAATGTCGGCCCA
>probe:Drosophila_2:1634668_at:511:307; Interrogation_Position=1697; Antisense; CCACCCTTATCTATATCTACCTTAG
>probe:Drosophila_2:1634668_at:530:411; Interrogation_Position=1721; Antisense; GACCATTTACAGACAAGACCTTTTT
>probe:Drosophila_2:1634668_at:372:205; Interrogation_Position=1779; Antisense; AAGCCTGTGTGTCATGGTCGTCCAA
>probe:Drosophila_2:1634668_at:368:461; Interrogation_Position=1817; Antisense; GATTTTAGCCTGTAGTCGAGTGTTT
>probe:Drosophila_2:1634668_at:604:695; Interrogation_Position=1860; Antisense; TTTCTATGCCATTTGTACTCTTATA
>probe:Drosophila_2:1634668_at:581:1; Interrogation_Position=1901; Antisense; ATGTTCTCCTTTCAAGTTAACCGCT
>probe:Drosophila_2:1634668_at:87:467; Interrogation_Position=1916; Antisense; GTTAACCGCTAATAAATCCGATTGA

Paste this into a BLAST search page for me
TGGGCTATCGGCCTTGCAGCATATTCACTTTTTTAACCTGCCCAATTGCTTTGCTCGACGAGATTGGTGCCACTGTGCCACTGCCCGTTTTATTTTATTTTTAATGTCGCATTTACTCGTCTGTAATAGAACAACTTGCGCCTCTTTGATATTCTCGATCAGGAATGTCGGCCCACCACCCTTATCTATATCTACCTTAGGACCATTTACAGACAAGACCTTTTTAAGCCTGTGTGTCATGGTCGTCCAAGATTTTAGCCTGTAGTCGAGTGTTTTTTCTATGCCATTTGTACTCTTATAATGTTCTCCTTTCAAGTTAACCGCTGTTAACCGCTAATAAATCCGATTGA

Full Affymetrix probeset data:

Annotations for 1634668_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720