FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634669_at:

>probe:Drosophila_2:1634669_at:653:501; Interrogation_Position=4194; Antisense; GTCGCCCATTCGCTGGGAACGATAA
>probe:Drosophila_2:1634669_at:310:549; Interrogation_Position=4225; Antisense; GGAGTGCTCTGGCTAGGCCACAAAT
>probe:Drosophila_2:1634669_at:442:159; Interrogation_Position=4244; Antisense; ACAAATGAGGCCTTTGCTCCCGCGA
>probe:Drosophila_2:1634669_at:449:51; Interrogation_Position=4395; Antisense; ATGCGAGATACCACCGATATGCGGA
>probe:Drosophila_2:1634669_at:47:561; Interrogation_Position=4417; Antisense; GGAACAGTTTCCTGTACCGGCTGAG
>probe:Drosophila_2:1634669_at:177:553; Interrogation_Position=4447; Antisense; GGAGCACCCTGCACCATTTCAAGAA
>probe:Drosophila_2:1634669_at:406:641; Interrogation_Position=4480; Antisense; TCTGTGGTTCTAGCCAGGATCGCTA
>probe:Drosophila_2:1634669_at:661:145; Interrogation_Position=4516; Antisense; ACTCGGCACGCTTGGAGCTTTGCAA
>probe:Drosophila_2:1634669_at:688:225; Interrogation_Position=4539; Antisense; AAGGCTGCCATGAGGGATAGCTCCT
>probe:Drosophila_2:1634669_at:41:27; Interrogation_Position=4555; Antisense; ATAGCTCCTCGTTGGGTACCATTTA
>probe:Drosophila_2:1634669_at:374:535; Interrogation_Position=4589; Antisense; GGTGCACAACATAATAGCTCCGATT
>probe:Drosophila_2:1634669_at:687:611; Interrogation_Position=4630; Antisense; TGACTTTGGCCCGATTCGATGTCCA
>probe:Drosophila_2:1634669_at:473:137; Interrogation_Position=4671; Antisense; ACGGCCAACACTTTGATCGGTCGAG
>probe:Drosophila_2:1634669_at:633:417; Interrogation_Position=4693; Antisense; GAGCGGCGCACATTGCTGTCCTGGA

Paste this into a BLAST search page for me
GTCGCCCATTCGCTGGGAACGATAAGGAGTGCTCTGGCTAGGCCACAAATACAAATGAGGCCTTTGCTCCCGCGAATGCGAGATACCACCGATATGCGGAGGAACAGTTTCCTGTACCGGCTGAGGGAGCACCCTGCACCATTTCAAGAATCTGTGGTTCTAGCCAGGATCGCTAACTCGGCACGCTTGGAGCTTTGCAAAAGGCTGCCATGAGGGATAGCTCCTATAGCTCCTCGTTGGGTACCATTTAGGTGCACAACATAATAGCTCCGATTTGACTTTGGCCCGATTCGATGTCCAACGGCCAACACTTTGATCGGTCGAGGAGCGGCGCACATTGCTGTCCTGGA

Full Affymetrix probeset data:

Annotations for 1634669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720