Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634670_at:

>probe:Drosophila_2:1634670_at:721:683; Interrogation_Position=395; Antisense; TATCCCCAGTAGTACGACATCCTGG
>probe:Drosophila_2:1634670_at:639:251; Interrogation_Position=424; Antisense; CAAAAACCACGGACATTACGACGCA
>probe:Drosophila_2:1634670_at:555:707; Interrogation_Position=439; Antisense; TTACGACGCACACATCCTGCGACAG
>probe:Drosophila_2:1634670_at:221:301; Interrogation_Position=475; Antisense; CCCAACATTTCCCACATTTTCAATA
>probe:Drosophila_2:1634670_at:498:59; Interrogation_Position=502; Antisense; ATGTAAACCAAACGATTCTCCGGAT
>probe:Drosophila_2:1634670_at:132:463; Interrogation_Position=515; Antisense; GATTCTCCGGATTCTTTCAATTCTT
>probe:Drosophila_2:1634670_at:381:463; Interrogation_Position=524; Antisense; GATTCTTTCAATTCTTGTTCCGATT
>probe:Drosophila_2:1634670_at:314:471; Interrogation_Position=540; Antisense; GTTCCGATTTGTATTCTTCATTCAT
>probe:Drosophila_2:1634670_at:30:483; Interrogation_Position=550; Antisense; GTATTCTTCATTCATTCCTTAAACA
>probe:Drosophila_2:1634670_at:349:493; Interrogation_Position=593; Antisense; GTAAGCCTACGTAATACTGAACAGC
>probe:Drosophila_2:1634670_at:65:387; Interrogation_Position=611; Antisense; GAACAGCAATCAATGCACTTTCCAT
>probe:Drosophila_2:1634670_at:49:617; Interrogation_Position=624; Antisense; TGCACTTTCCATAATTCTTAACTTA
>probe:Drosophila_2:1634670_at:90:159; Interrogation_Position=849; Antisense; TAGTTTCCGTTGATTTTAAGCCAAT
>probe:Drosophila_2:1634670_at:39:479; Interrogation_Position=879; Antisense; GTTTCAAAGCCTAGACACTCAGGAT

Paste this into a BLAST search page for me
TATCCCCAGTAGTACGACATCCTGGCAAAAACCACGGACATTACGACGCATTACGACGCACACATCCTGCGACAGCCCAACATTTCCCACATTTTCAATAATGTAAACCAAACGATTCTCCGGATGATTCTCCGGATTCTTTCAATTCTTGATTCTTTCAATTCTTGTTCCGATTGTTCCGATTTGTATTCTTCATTCATGTATTCTTCATTCATTCCTTAAACAGTAAGCCTACGTAATACTGAACAGCGAACAGCAATCAATGCACTTTCCATTGCACTTTCCATAATTCTTAACTTATAGTTTCCGTTGATTTTAAGCCAATGTTTCAAAGCCTAGACACTCAGGAT

Full Affymetrix probeset data:

Annotations for 1634670_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime