Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634671_a_at:

>probe:Drosophila_2:1634671_a_at:518:193; Interrogation_Position=100; Antisense; AACTCAACTGCGGAGGGCTTAGCCG
>probe:Drosophila_2:1634671_a_at:442:571; Interrogation_Position=115; Antisense; GGCTTAGCCGGCAATGGCAAAGAAA
>probe:Drosophila_2:1634671_a_at:247:69; Interrogation_Position=13; Antisense; ATGGCCATGGCAGACTGGTCGAACC
>probe:Drosophila_2:1634671_a_at:617:549; Interrogation_Position=164; Antisense; GGACGCGTGGGATCTTCCGGAACCA
>probe:Drosophila_2:1634671_a_at:282:379; Interrogation_Position=183; Antisense; GAACCACGACCCCACGAATATGGTG
>probe:Drosophila_2:1634671_a_at:429:411; Interrogation_Position=190; Antisense; GACCCCACGAATATGGTGGCCACTG
>probe:Drosophila_2:1634671_a_at:216:227; Interrogation_Position=220; Antisense; AAGGCCAAATTGTGCGGAGCTATTT
>probe:Drosophila_2:1634671_a_at:467:331; Interrogation_Position=233; Antisense; GCGGAGCTATTTGCCTGGATCTCAA
>probe:Drosophila_2:1634671_a_at:637:379; Interrogation_Position=33; Antisense; GAACCACCAGGTAGAGCATCAGCTT
>probe:Drosophila_2:1634671_a_at:721:101; Interrogation_Position=45; Antisense; AGAGCATCAGCTTGGCGTTTTGGAT
>probe:Drosophila_2:1634671_a_at:600:647; Interrogation_Position=51; Antisense; TCAGCTTGGCGTTTTGGATTTCAAA
>probe:Drosophila_2:1634671_a_at:461:543; Interrogation_Position=66; Antisense; GGATTTCAAACACCACCAGACTATA
>probe:Drosophila_2:1634671_a_at:61:157; Interrogation_Position=75; Antisense; ACACCACCAGACTATAATGACCATG
>probe:Drosophila_2:1634671_a_at:348:657; Interrogation_Position=89; Antisense; TAATGACCATGAACTCAACTGCGGA

Paste this into a BLAST search page for me
AACTCAACTGCGGAGGGCTTAGCCGGGCTTAGCCGGCAATGGCAAAGAAAATGGCCATGGCAGACTGGTCGAACCGGACGCGTGGGATCTTCCGGAACCAGAACCACGACCCCACGAATATGGTGGACCCCACGAATATGGTGGCCACTGAAGGCCAAATTGTGCGGAGCTATTTGCGGAGCTATTTGCCTGGATCTCAAGAACCACCAGGTAGAGCATCAGCTTAGAGCATCAGCTTGGCGTTTTGGATTCAGCTTGGCGTTTTGGATTTCAAAGGATTTCAAACACCACCAGACTATAACACCACCAGACTATAATGACCATGTAATGACCATGAACTCAACTGCGGA

Full Affymetrix probeset data:

Annotations for 1634671_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime