Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634672_at:

>probe:Drosophila_2:1634672_at:151:299; Interrogation_Position=1659; Antisense; CGCTGTATGAGCGTTTGTCACTATA
>probe:Drosophila_2:1634672_at:109:665; Interrogation_Position=1682; Antisense; TACAAGGAGGATCAGTCCCTGCACA
>probe:Drosophila_2:1634672_at:178:251; Interrogation_Position=1708; Antisense; CAAGGCGCCTAACGTGTTCAAGCTA
>probe:Drosophila_2:1634672_at:541:601; Interrogation_Position=1722; Antisense; TGTTCAAGCTAACCCCTGACATGGA
>probe:Drosophila_2:1634672_at:520:381; Interrogation_Position=1745; Antisense; GAACCCATACCATGCAAACCGATTT
>probe:Drosophila_2:1634672_at:66:203; Interrogation_Position=1761; Antisense; AACCGATTTTCTTTGACCTGGCTAT
>probe:Drosophila_2:1634672_at:263:611; Interrogation_Position=1774; Antisense; TGACCTGGCTATGACCTACGTGGAG
>probe:Drosophila_2:1634672_at:398:563; Interrogation_Position=1814; Antisense; GGCAAACTTGAATCGCCCGGCAAGA
>probe:Drosophila_2:1634672_at:602:393; Interrogation_Position=1837; Antisense; GAAAGGAGCCTCCATTACCGGCTTT
>probe:Drosophila_2:1634672_at:354:245; Interrogation_Position=1852; Antisense; TACCGGCTTTGTCAAGGGATTCCTC
>probe:Drosophila_2:1634672_at:676:481; Interrogation_Position=1926; Antisense; GTATTCTTCTGGAATTCCACGCATC
>probe:Drosophila_2:1634672_at:482:629; Interrogation_Position=1941; Antisense; TCCACGCATCCATGTTACACTTATA
>probe:Drosophila_2:1634672_at:494:663; Interrogation_Position=1964; Antisense; TAAAGCCTTTAGATCCATGTCCACG
>probe:Drosophila_2:1634672_at:699:259; Interrogation_Position=1985; Antisense; CACGCTGCGGTATGTCCGTTTTATA

Paste this into a BLAST search page for me
CGCTGTATGAGCGTTTGTCACTATATACAAGGAGGATCAGTCCCTGCACACAAGGCGCCTAACGTGTTCAAGCTATGTTCAAGCTAACCCCTGACATGGAGAACCCATACCATGCAAACCGATTTAACCGATTTTCTTTGACCTGGCTATTGACCTGGCTATGACCTACGTGGAGGGCAAACTTGAATCGCCCGGCAAGAGAAAGGAGCCTCCATTACCGGCTTTTACCGGCTTTGTCAAGGGATTCCTCGTATTCTTCTGGAATTCCACGCATCTCCACGCATCCATGTTACACTTATATAAAGCCTTTAGATCCATGTCCACGCACGCTGCGGTATGTCCGTTTTATA

Full Affymetrix probeset data:

Annotations for 1634672_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime