FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634674_at:

>probe:Drosophila_2:1634674_at:537:97; Interrogation_Position=1000; Antisense; AGATCTGCCATGTGATACCCTGTCA
>probe:Drosophila_2:1634674_at:714:283; Interrogation_Position=1019; Antisense; CTGTCATCCGGGTCTTAACCTTAAT
>probe:Drosophila_2:1634674_at:310:73; Interrogation_Position=1048; Antisense; AGGACGTTGGACACACTGTCTGCTG
>probe:Drosophila_2:1634674_at:107:325; Interrogation_Position=1072; Antisense; GCGATCCGTACCGTTTTATTACCAT
>probe:Drosophila_2:1634674_at:570:703; Interrogation_Position=1087; Antisense; TTATTACCATAAACGCTCCACACTT
>probe:Drosophila_2:1634674_at:662:133; Interrogation_Position=1099; Antisense; ACGCTCCACACTTAACTGGTGTTTG
>probe:Drosophila_2:1634674_at:562:55; Interrogation_Position=603; Antisense; ATGACACCGGCTTCTGCATTTATAT
>probe:Drosophila_2:1634674_at:12:473; Interrogation_Position=650; Antisense; GTTCAGGTATCTAAACGCTATCCCC
>probe:Drosophila_2:1634674_at:473:225; Interrogation_Position=705; Antisense; AAGGCCGTTGAGACCTGGGTGAACA
>probe:Drosophila_2:1634674_at:548:27; Interrogation_Position=777; Antisense; ATACCGCGTACTTACGATGTCCTTA
>probe:Drosophila_2:1634674_at:251:247; Interrogation_Position=890; Antisense; AATTCCCGTGCCAGAGTGGATGTAC
>probe:Drosophila_2:1634674_at:465:215; Interrogation_Position=915; Antisense; AAGATAGTTAGCCATCTCTCCGGAG
>probe:Drosophila_2:1634674_at:180:61; Interrogation_Position=944; Antisense; ATGGGTAATGCTGACCTACAACGAC
>probe:Drosophila_2:1634674_at:48:659; Interrogation_Position=970; Antisense; TAAGTCTACCCAATCAGCAGGCATT

Paste this into a BLAST search page for me
AGATCTGCCATGTGATACCCTGTCACTGTCATCCGGGTCTTAACCTTAATAGGACGTTGGACACACTGTCTGCTGGCGATCCGTACCGTTTTATTACCATTTATTACCATAAACGCTCCACACTTACGCTCCACACTTAACTGGTGTTTGATGACACCGGCTTCTGCATTTATATGTTCAGGTATCTAAACGCTATCCCCAAGGCCGTTGAGACCTGGGTGAACAATACCGCGTACTTACGATGTCCTTAAATTCCCGTGCCAGAGTGGATGTACAAGATAGTTAGCCATCTCTCCGGAGATGGGTAATGCTGACCTACAACGACTAAGTCTACCCAATCAGCAGGCATT

Full Affymetrix probeset data:

Annotations for 1634674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720