Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634677_at:

>probe:Drosophila_2:1634677_at:528:577; Interrogation_Position=1086; Antisense; GGCCCAGCTATTTCATTTGCAGGAC
>probe:Drosophila_2:1634677_at:34:321; Interrogation_Position=565; Antisense; GCCCAACTCCTAAATGAGGCCTACA
>probe:Drosophila_2:1634677_at:91:71; Interrogation_Position=581; Antisense; AGGCCTACACGAAGATGACCTCGGA
>probe:Drosophila_2:1634677_at:162:99; Interrogation_Position=593; Antisense; AGATGACCTCGGACATCCTGGCGGA
>probe:Drosophila_2:1634677_at:574:419; Interrogation_Position=643; Antisense; GAGCATCCGGGCGAGCTGATCCGCA
>probe:Drosophila_2:1634677_at:299:711; Interrogation_Position=739; Antisense; TTCAAGGTCGTCTCGCTGGGCGACA
>probe:Drosophila_2:1634677_at:67:299; Interrogation_Position=752; Antisense; CGCTGGGCGACATTATGGACGGAAC
>probe:Drosophila_2:1634677_at:73:609; Interrogation_Position=804; Antisense; TGAGAACTACTGTGCGGAGCTGCGC
>probe:Drosophila_2:1634677_at:173:119; Interrogation_Position=821; Antisense; AGCTGCGCAACTGCACGGCGGTGAT
>probe:Drosophila_2:1634677_at:713:577; Interrogation_Position=858; Antisense; GGCCAAGTTCAATGACCTCAGGTTC
>probe:Drosophila_2:1634677_at:459:229; Interrogation_Position=868; Antisense; AATGACCTCAGGTTCGTCGGGCGGA
>probe:Drosophila_2:1634677_at:106:287; Interrogation_Position=894; Antisense; CGGCAGAGGGAAAAGCTTCACGCTA
>probe:Drosophila_2:1634677_at:606:515; Interrogation_Position=928; Antisense; GTGTCAACGAATCCACCGCACATAG
>probe:Drosophila_2:1634677_at:249:221; Interrogation_Position=974; Antisense; AAGTGACTGTCGATGGGCCACGCGA

Paste this into a BLAST search page for me
GGCCCAGCTATTTCATTTGCAGGACGCCCAACTCCTAAATGAGGCCTACAAGGCCTACACGAAGATGACCTCGGAAGATGACCTCGGACATCCTGGCGGAGAGCATCCGGGCGAGCTGATCCGCATTCAAGGTCGTCTCGCTGGGCGACACGCTGGGCGACATTATGGACGGAACTGAGAACTACTGTGCGGAGCTGCGCAGCTGCGCAACTGCACGGCGGTGATGGCCAAGTTCAATGACCTCAGGTTCAATGACCTCAGGTTCGTCGGGCGGACGGCAGAGGGAAAAGCTTCACGCTAGTGTCAACGAATCCACCGCACATAGAAGTGACTGTCGATGGGCCACGCGA

Full Affymetrix probeset data:

Annotations for 1634677_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime