FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634678_at:

>probe:Drosophila_2:1634678_at:679:471; Interrogation_Position=452; Antisense; GTTAAGCCAACTGGATTTGCTGGTA
>probe:Drosophila_2:1634678_at:641:603; Interrogation_Position=485; Antisense; TGATCTTATGGAAAACGACTGGCTA
>probe:Drosophila_2:1634678_at:387:407; Interrogation_Position=501; Antisense; GACTGGCTAAAGAACAATCGCTTGT
>probe:Drosophila_2:1634678_at:262:237; Interrogation_Position=516; Antisense; AATCGCTTGTGTCTGTGGCGCAAAG
>probe:Drosophila_2:1634678_at:254:367; Interrogation_Position=551; Antisense; GAATCTGCTTCAGAAGTATCTGCGG
>probe:Drosophila_2:1634678_at:466:91; Interrogation_Position=565; Antisense; AGTATCTGCGGGTCAAGTCGGCTGC
>probe:Drosophila_2:1634678_at:326:437; Interrogation_Position=597; Antisense; GAGGAGCTGCTCTTTACCTCCAGTT
>probe:Drosophila_2:1634678_at:69:131; Interrogation_Position=612; Antisense; ACCTCCAGTTCTGTATATTCCAGTT
>probe:Drosophila_2:1634678_at:626:605; Interrogation_Position=641; Antisense; TGATCAGCAGACGAGCGACTTCATA
>probe:Drosophila_2:1634678_at:706:167; Interrogation_Position=672; Antisense; AAAGTCAACTGCTTGGATCCCAACA
>probe:Drosophila_2:1634678_at:310:587; Interrogation_Position=685; Antisense; TGGATCCCAACAACAGACGTATTAA
>probe:Drosophila_2:1634678_at:19:663; Interrogation_Position=707; Antisense; TAAACTGCACGATCTGGAGGCGATT
>probe:Drosophila_2:1634678_at:686:629; Interrogation_Position=741; Antisense; TCCGTGGAACTACAATCAGAGCGAA
>probe:Drosophila_2:1634678_at:319:163; Interrogation_Position=923; Antisense; AAATTTCCTTGTAACAGCTATGTGA

Paste this into a BLAST search page for me
GTTAAGCCAACTGGATTTGCTGGTATGATCTTATGGAAAACGACTGGCTAGACTGGCTAAAGAACAATCGCTTGTAATCGCTTGTGTCTGTGGCGCAAAGGAATCTGCTTCAGAAGTATCTGCGGAGTATCTGCGGGTCAAGTCGGCTGCGAGGAGCTGCTCTTTACCTCCAGTTACCTCCAGTTCTGTATATTCCAGTTTGATCAGCAGACGAGCGACTTCATAAAAGTCAACTGCTTGGATCCCAACATGGATCCCAACAACAGACGTATTAATAAACTGCACGATCTGGAGGCGATTTCCGTGGAACTACAATCAGAGCGAAAAATTTCCTTGTAACAGCTATGTGA

Full Affymetrix probeset data:

Annotations for 1634678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720