FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634683_at:

>probe:Drosophila_2:1634683_at:586:13; Interrogation_Position=2089; Antisense; ATTAATGATCTATGCCCATTGGCAA
>probe:Drosophila_2:1634683_at:391:625; Interrogation_Position=2101; Antisense; TGCCCATTGGCAAAACAGTTCTTGT
>probe:Drosophila_2:1634683_at:565:473; Interrogation_Position=2124; Antisense; GTTCAAGTCTATTTCAAGTGCTAAT
>probe:Drosophila_2:1634683_at:471:63; Interrogation_Position=2150; Antisense; ATGTGTCATTGCAAAACTGCTTTAA
>probe:Drosophila_2:1634683_at:577:165; Interrogation_Position=2274; Antisense; AAATGATTTTGAAGAAGCCCTAGCT
>probe:Drosophila_2:1634683_at:284:379; Interrogation_Position=2287; Antisense; GAAGCCCTAGCTTATGTTTTATTTT
>probe:Drosophila_2:1634683_at:78:703; Interrogation_Position=2305; Antisense; TTATTTTTCTCATTTGCGGTTCGCC
>probe:Drosophila_2:1634683_at:425:329; Interrogation_Position=2320; Antisense; GCGGTTCGCCTTGGATCAACGAATT
>probe:Drosophila_2:1634683_at:176:339; Interrogation_Position=2460; Antisense; GCTACTGAATCAATACGTTTTCCCA
>probe:Drosophila_2:1634683_at:24:139; Interrogation_Position=2474; Antisense; ACGTTTTCCCAGACAATGATCTTTT
>probe:Drosophila_2:1634683_at:365:705; Interrogation_Position=2525; Antisense; TTAGACCACGAGAAAATTGCCTTTT
>probe:Drosophila_2:1634683_at:689:189; Interrogation_Position=2569; Antisense; AACTTTACTCTAGTTATCGTAAGCT
>probe:Drosophila_2:1634683_at:480:291; Interrogation_Position=2586; Antisense; CGTAAGCTTATGATTTTCTCTGATT
>probe:Drosophila_2:1634683_at:685:363; Interrogation_Position=2618; Antisense; GAATTACACTTTTGTGCGCAGAAAA

Paste this into a BLAST search page for me
ATTAATGATCTATGCCCATTGGCAATGCCCATTGGCAAAACAGTTCTTGTGTTCAAGTCTATTTCAAGTGCTAATATGTGTCATTGCAAAACTGCTTTAAAAATGATTTTGAAGAAGCCCTAGCTGAAGCCCTAGCTTATGTTTTATTTTTTATTTTTCTCATTTGCGGTTCGCCGCGGTTCGCCTTGGATCAACGAATTGCTACTGAATCAATACGTTTTCCCAACGTTTTCCCAGACAATGATCTTTTTTAGACCACGAGAAAATTGCCTTTTAACTTTACTCTAGTTATCGTAAGCTCGTAAGCTTATGATTTTCTCTGATTGAATTACACTTTTGTGCGCAGAAAA

Full Affymetrix probeset data:

Annotations for 1634683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720