FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634684_at:

>probe:Drosophila_2:1634684_at:57:269; Interrogation_Position=1048; Antisense; CTAACTAAGTTGCTAGCTAACCTAG
>probe:Drosophila_2:1634684_at:327:335; Interrogation_Position=610; Antisense; GCTGCATCTGCCGAAAATCATTGAG
>probe:Drosophila_2:1634684_at:695:111; Interrogation_Position=641; Antisense; AGCACCGAGGGAATGCCGTTCCCGA
>probe:Drosophila_2:1634684_at:125:3; Interrogation_Position=658; Antisense; GTTCCCGATTATCTTTGCCGGTAAT
>probe:Drosophila_2:1634684_at:186:313; Interrogation_Position=674; Antisense; GCCGGTAATCTGGTGGCATTTTCCT
>probe:Drosophila_2:1634684_at:486:345; Interrogation_Position=689; Antisense; GCATTTTCCTGGACGCTGTATGCCA
>probe:Drosophila_2:1634684_at:646:333; Interrogation_Position=703; Antisense; GCTGTATGCCATCTCCATCAAGAAT
>probe:Drosophila_2:1634684_at:683:239; Interrogation_Position=725; Antisense; AATACTGTGATGGTGCTGCAGAACC
>probe:Drosophila_2:1634684_at:56:335; Interrogation_Position=739; Antisense; GCTGCAGAACCTTTTGCTGCTGGTC
>probe:Drosophila_2:1634684_at:409:593; Interrogation_Position=765; Antisense; TGGGCGGCATTCAGCTCTCCATGTT
>probe:Drosophila_2:1634684_at:366:641; Interrogation_Position=780; Antisense; TCTCCATGTTCGCTATTTATCCCAA
>probe:Drosophila_2:1634684_at:131:339; Interrogation_Position=791; Antisense; GCTATTTATCCCAACAAACCGGCTG
>probe:Drosophila_2:1634684_at:566:563; Interrogation_Position=852; Antisense; TGAAATCGAACGCTTTACCTAGAAA
>probe:Drosophila_2:1634684_at:570:363; Interrogation_Position=958; Antisense; GAATTTACACTAAACCGCCACAAGA

Paste this into a BLAST search page for me
CTAACTAAGTTGCTAGCTAACCTAGGCTGCATCTGCCGAAAATCATTGAGAGCACCGAGGGAATGCCGTTCCCGAGTTCCCGATTATCTTTGCCGGTAATGCCGGTAATCTGGTGGCATTTTCCTGCATTTTCCTGGACGCTGTATGCCAGCTGTATGCCATCTCCATCAAGAATAATACTGTGATGGTGCTGCAGAACCGCTGCAGAACCTTTTGCTGCTGGTCTGGGCGGCATTCAGCTCTCCATGTTTCTCCATGTTCGCTATTTATCCCAAGCTATTTATCCCAACAAACCGGCTGTGAAATCGAACGCTTTACCTAGAAAGAATTTACACTAAACCGCCACAAGA

Full Affymetrix probeset data:

Annotations for 1634684_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720