FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634685_at:

>probe:Drosophila_2:1634685_at:305:253; Interrogation_Position=403; Antisense; CAAGAACTGGTATGTATCCGAGGAC
>probe:Drosophila_2:1634685_at:377:677; Interrogation_Position=413; Antisense; TATGTATCCGAGGACCACGTGGTCG
>probe:Drosophila_2:1634685_at:506:591; Interrogation_Position=432; Antisense; TGGTCGTTCTTCCTACTCCATTTGT
>probe:Drosophila_2:1634685_at:657:669; Interrogation_Position=445; Antisense; TACTCCATTTGTCGCCATTTTCTTT
>probe:Drosophila_2:1634685_at:529:261; Interrogation_Position=460; Antisense; CATTTTCTTTGCACCGGGTGTACAC
>probe:Drosophila_2:1634685_at:482:617; Interrogation_Position=469; Antisense; TGCACCGGGTGTACACACACACAAA
>probe:Drosophila_2:1634685_at:91:185; Interrogation_Position=491; Antisense; AAAATGGCAGCCGACACGTGCTTTC
>probe:Drosophila_2:1634685_at:589:139; Interrogation_Position=506; Antisense; ACGTGCTTTCTACTCGAGTCTGGAT
>probe:Drosophila_2:1634685_at:219:645; Interrogation_Position=514; Antisense; TCTACTCGAGTCTGGATGATGAAAC
>probe:Drosophila_2:1634685_at:260:199; Interrogation_Position=536; Antisense; AACGATGGTATCTGAATGAGCAAAT
>probe:Drosophila_2:1634685_at:389:609; Interrogation_Position=567; Antisense; TGAGAAGCCTTTTACCATCTGCTGC
>probe:Drosophila_2:1634685_at:75:277; Interrogation_Position=596; Antisense; CTTCTGATCGGCCTCTTAGAAAATA
>probe:Drosophila_2:1634685_at:86:207; Interrogation_Position=620; Antisense; AAGCGATTGATTTTGCTGCAATACA
>probe:Drosophila_2:1634685_at:166:165; Interrogation_Position=668; Antisense; AAATCAACCAGTGCGCTGTTTTGTG

Paste this into a BLAST search page for me
CAAGAACTGGTATGTATCCGAGGACTATGTATCCGAGGACCACGTGGTCGTGGTCGTTCTTCCTACTCCATTTGTTACTCCATTTGTCGCCATTTTCTTTCATTTTCTTTGCACCGGGTGTACACTGCACCGGGTGTACACACACACAAAAAAATGGCAGCCGACACGTGCTTTCACGTGCTTTCTACTCGAGTCTGGATTCTACTCGAGTCTGGATGATGAAACAACGATGGTATCTGAATGAGCAAATTGAGAAGCCTTTTACCATCTGCTGCCTTCTGATCGGCCTCTTAGAAAATAAAGCGATTGATTTTGCTGCAATACAAAATCAACCAGTGCGCTGTTTTGTG

Full Affymetrix probeset data:

Annotations for 1634685_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720